PLoS Neglected Tropical Diseases
image
Tumor Necrosis Factor and Schistosoma mansoni egg antigen omega-1 shape distinct aspects of the early egg-induced granulomatous response
DOI 10.1371/journal.pntd.0008814 , Volume: 15 , Issue: 1
Article Type: research-article, Article History
Abstract

Schistosomiasis is a disease caused by parasitic flatworms which lay eggs within the veins of their human host. Upon sensing the parasite egg, macrophages, the first line defense cells, aggregate tightly around the egg to encapsulate it within an immune structure known as a granuloma. These granulomas are the key pathological structures which determine both host disease outcome and parasite transmission. Studies in mice have implicated omega-1, a secreted parasite protein. Omega-1 is an RNase, an enzyme that degrades host RNA. Mouse studies have also suggested that a host defense protein, Tumor Necrosis Factor (TNF), is required to form granulomas around the egg. We used the small and transparent zebrafish larva to examine the requirement of omega-1 and TNF for granuloma formation. We find that omega-1 induces rapid macrophage migration and that its RNase activity is required for this. In contrast, TNF is not involved in the initial recruitment of macrophages. Rather, it enlarges granulomas after they are initiated. These findings improve our understanding of the role of omega-1 and TNF, and show that they impact distinct facets of granuloma formation around Schistosoma eggs.

Takaki, Roca, Schramm, Wilbers, Ittiprasert, Brindley, Rinaldi, Berriman, Ramakrishnan, Pagán, and Dalton: Tumor Necrosis Factor and Schistosoma mansoni egg antigen omega-1 shape distinct aspects of the early egg-induced granulomatous response

Introduction

Schistosomiasis is a major granulomatous disease, caused by parasitic flatworms of the genus Schistosoma with Schistosoma mansoni being the most widespread agent of the disease [1]. The events of Schistosoma egg-induced granulomas have been deduced mainly from histological assessments of human clinical samples and the use of experimental mammalian models [2,3]. We have recently reported the use of the optically transparent and genetically tractable zebrafish larva as a model to study early macrophage recruitment and granuloma formation in response to S. mansoni eggs [4]. Because the zebrafish larva lacks adaptive immunity during their first few weeks of development, this model can be used to dissect mechanisms in the sole context of innate immunity [46]. We found that while epithelioid granulomas form rapidly around mature eggs, immature eggs fail to provoke granulomas, consistent with the mature stage-specific secretion of antigens and their function to induce granuloma formation in mammalian models [4,712].

In the zebrafish, we can additionally examine macrophage recruitment within hours of implantation, and find that whereas injections of schistosome soluble egg antigen (SEA) obtained from mature eggs induce early macrophage recruitment, implantation of immature eggs fail to do so [4]. Together these findings both validate the zebrafish model to study S. mansoni egg-induced granuloma formation and reveal new insights into the underlying molecular mechanisms [4].

In mice, the cytokine Tumor Necrosis Factor (TNF) and the S. mansoni secreted antigen omega-1 have been identified as host and parasite factors, respectively, that promote granuloma formation around the egg [1317]. However, the role of TNF remains controversial and the mechanism by which omega-1 exerts its role is unresolved. In this work, we use the zebrafish model to explore their roles in macrophage recruitment and innate granuloma formation.

Materials and methods

Ethics statement

All animal experiments were conducted in compliance with guidelines from the UK Home Office and approved by the Wellcome Sanger Institute (WSI) Animal Welfare and Ethical Review Body (AWERB).

Zebrafish husbandry

All zebrafish lines were maintained on a recirculating aquaculture system with a 14 hour light—10 hour dark cycle. Fish were fed dry food and brine shrimp twice a day. Zebrafish embryos were housed in fish water (reverse osmosis water containing 0.18 g/l Instant Ocean) at 28.5°C. Embryos were maintained in 0.25 μg/ml methylene blue from collection to 1 day post-fertilization (dpf). At 24 hours post-fertilization 0.003% PTU (1-phenyl-2-thiourea, Sigma) was added to prevent pigmentation.

Generation of the TNFR1 mutant and its usage

The zebrafish TNFR1 mutant (tnfrsf1arr19) was generated using CRISPR Cas9 technology, targeting the sequence TGGTGGAAACAAGACTATGAA of the third exon of the gene (ENSG00000067182) using a T7 promoter-generated guide RNA. Sequencing verified the mutation as a 25 bp deletion (ATGAAGGGAAATTGTCTTGAAAATG) and 6 bp insertion (TGGTGG), resulting in a frame shift and introduction of a premature stop codon soon after the start codon. HRM genotyping was performed using the TNFR1-HRM1- forward and reverse primer set (5’-GTTCCCCACAGGTTCTAACCAG-3’ and 5’-CTTGATGGCATTTATCACAGCAGA-3’, respectively). TNFR1 heterozygotes in the macrophage reporter background, Tg(mpeg1:YFP)w200 [18], were incrossed, genotyped, and sorted as fluorescence-positive, homozygous TNFR1 mutants or WT siblings. Homozygous TNFR1 mutants or WT siblings were then incrossed to generate larvae for experiments.

Soluble egg antigens, WT and RNase mutant recombinant omega-1

For preparation of SEA, eggs were isolated from S. mansoni -infected hamsters as previously described [19], and then homogenized in PBS, pH 7.5, using a sterile glass homogenizer. The homogenate was then centrifuged at 21 krcf for 20 minutes. Supernatants were pooled and then dialyzed overnight in PBS using a 3.5 kDa molecular weight cutoff dialyzer. Sample was then centrifuged at 21 krcf for 20 minutes, and supernatant (SEA) was aliquoted and stored at -80°C. SEA was quantified for protein concentration using the Micro-BCA assay (Pierce, 23225), and quality controlled by SDS-PAGE and western blotting against the S. mansoni antigens, omega-1, alpha-1, and kappa-5. Quality control for low LPS content was performed using the Chromo-LAL assay (Associate of Cape Cod, Inc., C0031-5). SEA from WT and corresponding omega-1 knockout eggs were injected at 1 ng per hindbrain ventricle. For comparison of SEA and plant-expressed omega-1, SEA was injected at 2 ng per hindbrain ventricle (1.5 nL injection of 1.4 mg/mL SEA), and plant-expressed omega-1 with LeX glycans [20] was injected at 0.02 ng per hindbrain ventricle, the relative concentration of omega-1 present in SEA (G. Schramm, personal communication). For DEPC inactivation of plant-expressed omega-1, 1 μL of 0.07 M DEPC (1/100 dilution of Sigma, D5758) was added to 5 μL of 1.5 mg/mL omega-1 (12 mM final concentration of DEPC), and then incubated for 1 hour at 37°C. Because the small volume of protein did not allow for ultrafiltration and requantification of protein, the sample was simply diluted 1/100 in PBS and then 0.02 ng of protein injected into the hindbrain ventricle. For comparison, control sample was incubated at 37°C (without DEPC-treatment) and then diluted 1/100 in PBS. Because the HEK-expressed WT and RNase mutant omega-1 (H58F) lack the native-like LeX glycans in plant-expressed and natural omega-1 [21,22], they were injected at a 5-fold higher concentration of 0.1 ng per hindbrain ventricle. All hindbrain injections of antigens were assayed at 6 hours post-injection.

Hindbrain injection of antigens

Hindbrain injections were performed as previously described [5] using 2 ng of WT or Δω1 SEA, 0.02 ng of plant-expressed omega-1 untreated or DEPC-treated, or 0.1 ng of HEK-expressed WT or RNase mutant omega-1.

Hindbrain implantation of eggs

Schistosome eggs were individually implanted into the zebrafish hindbrain ventricle as previously described [4]. Briefly, an incision was made into the zebrafish using a microinjection needle, after which an individual egg was passed though the incision and implanted into the hindbrain ventricle.

Bacterial infections and quantification of infection burden

Bacterial infections and quantification of infection burden was performed as previously described [5]. Briefly, 75 CFU Mycobacterium marinum M strain was microinjected into the caudal vein of zebrafish larvae at 36 hours post-fertilization. At 4 days post-infection larvae were imaged by inverted fluorescence microscopy and bacterial fluorescence quantified from images.

Confocal microscopy

Zebrafish were anesthetized in fish water containing tricaine and then and mounted onto optical bottom plates (MatTek Corporation, P06G-1.5-20-F) in 1% low melting point agarose (Invitrogen, 16520–100) as previously described [5]. Microscopy was performed using a Nikon A1 confocal laser scanning confocal microscopy with a 20x Plan Apo 0.75 NA objective and a Galvano scanner, acquiring 30–80 μm z-stacks with 2–3 μm z-step intervals. Timelapse microscopy was performed at physiological temperature using a heat chamber set to 28°C (Okolab) with an acquisition interval of 3 minutes.

Granuloma quantification

Confocal images were used for quantifying the number of macrophages in contact with the egg, and subsequent classification of the immune response. Granuloma size was quantified by fluorescence analysis of confocal z-stacks which were flattened, and then fluorescent macrophages comprising the granuloma area was measured by fluorescent pixel counts (FPC) [5].

Quantification of macrophage recruitment

Quantification of macrophage recruitment was performed by counting the number of fluorescently labeled macrophages within the hindbrain ventricle by fluorescence microscopy. Experiments quantifying macrophage recruitment following injection of egg antigens, utilized Tg(mpeg1:Brainbow)w201 larvae [23].

Results

TNF signaling through TNF Receptor 1 promotes macrophage recruitment to nascent S. mansoni egg-induced granulomas but is dispensable for initial macrophage recruitment to the eggs

The role of TNF in S. mansoni egg-induced granulomas remains unresolved after two decades of studies in the murine model of schistosomiasis. Early findings showed that S. mansoni -infected SCID mice were deficient in both granuloma formation and egg extrusion, phenotypes which was rescued by recombinant TNF and activated T cell medium, but not by TNF-depleted T cell medium [13]. These findings suggested a role for TNF in granuloma formation and egg excretion [13]. However, subsequent work from this group found that TNF knockout mice did not have a defect in granuloma formation [24]. Mice lacking both receptors through which TNF signals did exhibit a mild granuloma deficit, leading the authors to propose that it might be due to a defect in signaling of the ligand lymphotoxin [24]. However, this would not explain their earlier findings that exogenous TNF rescued granuloma formation in SCID mice [13]. Meanwhile, a different group reported that TNF did not rescue granuloma formation in SCID mice [25]. Additionally, S. mansoni -infected SCID mice displayed normal levels of TNF expression, suggesting that other cells may be the major source of TNF during the infection [25]. It has been suggested that Ly6Chi monocytes, which are known to express TNF in response to the schistosome egg, might be the innate source of TNF [26].

To delineate the role of TNF in macrophage recruitment and granuloma formation around S. mansoni eggs, we used a TNFR1 zebrafish mutant created by CRISPR-Cas technology (see Materials and Methods). We first confirmed that the lack of TNFR1 signaling rendered zebrafish larvae susceptible to Mycobacterium marinum infection, consistent to our previous findings using TNFR1 morpholino [27] (S1 Fig). Next, we implanted the Hindbrain Ventricle (HBV) of wildtype and TNFR1 mutant larvae with S. mansoni eggs and evaluated granuloma formation after five days (Fig 1A–1C). We have recently categorized early macrophage recruitment and granuloma formation based on the number and characteristics of macrophages in contact with the egg: Minimal recruitment, 0–6 macrophages; Macrophages recruited, >6 macrophages; Granulomas, confluent epithelioid macrophage aggregates [4]. At 5 days post-implantation of the eggs, the TNFR1 mutants had similar macrophage responses to wildtype animals with ~50% of the animals forming epithelioid granulomas in each group (Fig 1B ). However, we found that the TNFR1 deficient granulomas were significantly smaller than wildtype granulomas, with the mean granuloma size being 62% smaller than in wildtype (Fig 1C and 1D). We also noted that the TNFR1 mutant granulomas, though smaller, showed a characteristic epithelioid morphology with confluent macrophages and loss of intercellular boundaries. This finding suggest that epithelioid transformation may also be independent of TNFR1 signaling [4] Fig 1D). Because the S. mansoni granuloma is comprised solely of macrophages at this early stage [4], our findings imply that TNFR1 signaling would promote macrophage recruitment to a nascent granuloma around the egg. In the zebrafish model, we can also examine the initiation of macrophage recruitment to S. mansoni eggs within hours of implantation [4]. However, we found that TNFR1 signaling is not required for initiation of macrophage recruitment (Fig 1E).

TNF affects late-stage granuloma formation.
Fig 1
Comparison of macrophage recruitment and granuloma formation in WT and TNFR1 mutant zebrafish larvae with fluorescent macrophages following implantation with a single schistosome egg into their hindbrain ventricle. (A) Zebrafish larva at 36 hours post-fertilization with the hindbrain ventricle (HBV) site of injection and implantation outlined. Scale bar, 300 μm. (B-D) Granuloma formation at 5 days post-implantation. (B ) Percent of animals with; granuloma formation (confluent epithelioid macrophage aggregates), macrophages recruited (>6 macrophages in contact with the egg), or minimal recruitment (0–6 macrophages in contact with egg) [4]. (C) Granuloma size and (D) images, with each image from top to bottom corresponding with each red data point, top to bottom, respectively. Scale bar, 50 μm. Horizontal bars in (C), means. Statistics, Student’s t-test. (E) Mean macrophage recruitment kinetics during the first 6 hours post-implantation. Error bars, SEM. Sample size, n = 5 animals per group.TNF affects late-stage granuloma formation.

Together, these results show that TNF signaling through TNFR1 is required specifically for macrophage recruitment after the initial macrophages reach the egg through other signal(s). Thereby, TNF mediates granuloma enlargement rather than granuloma initiation. Furthermore, TNFR1 is not required for epithelioid transformation. Finally, TNF plays a role in the granulomatous response in the sole context of innate immunity.

S. mansoni omega-1 promotes initial macrophage recruitment to the egg through its RNase activity

Next, we wanted to probe the parasite determinants that induce granuloma formation. In recent work we found that immature S. mansoni eggs invoked neither granuloma formation nor even initial macrophage recruitment, indicating that mature egg antigens were required for the first macrophages to be recruited to the egg [4]. Mature eggs express a variety of antigens [7,28,29], of which omega-1 is known to be the major contributor to granuloma formation, as knockdown of its expression leads to greatly diminished granuloma formation around eggs [16,17]. Omega-1 is an RNase involved in several processes. In dendritic cells, it inhibits protein synthesis, alters cell morphology, induces IL-33 expression, and reduces conjugation affinity with T cells [21,22,30,31]. If and how this leads to granuloma formation is not known. However, it is well-established that its RNase activity is essential for inducing the Th2 polarization of granulomas [21,22,30,31]. This in turn induces expression of IL-4 and IL-13, known egg-induced host factors that can mediate granuloma formation [25,32,33]. Additionally, omega-1 is a major hepatotoxin [28,34,35], and it has been proposed that the granuloma itself would prevent the cytotoxic effects of this egg antigen on the host liver.

Our attempts to test the role of omega-1 by implanting omega-1 knockout (KO) eggs [17] into the larvae failed, as the genetically modified eggs did not survive shipment. As an alternative approach, we tested if the SEA obtained from omega-1 KO eggs could recruited macrophages. We examined macrophage recruitment 6 hours post-injection of the SEA into the hindbrain ventricle (Fig 1A). Omega-1-deficient SEA recruited macrophages similar to wildtype SEA (Fig 2A ). Knockdown of omega-1 expression is not 100% efficient, with pools of CRISPR/Cas9-treated eggs still retaining ~20% of the omega-1 transcript, and their SEA still retaining ~20% of its RNase activity, suggesting that even though reduced compared to wild type eggs, the residual omega-1 may still be sufficient for macrophage recruitment [17]. Alternatively, the omega-1 activity may be redundant with other SEA components [36]. To investigate these hypotheses, we used a recombinant omega-1 that contain the native-like LeX glycosylation, which is important for its uptake by dendritic cells and subsequent Th2 polarization [20,21]. Injection of 0.02 ng of omega-1, the approximate amount of omega-1 in the corresponding SEA injections [4], induced macrophage recruitment, although less than SEA, consistent with other components inducing macrophage recruitment (Fig 2B and 2C).

Omega-1 recruits macrophages via its RNase activity.
Fig 2
Macrophage recruitment at 6 hours post-injection (hpi) with egg antigens. (A) Macrophages recruited to SEA from WT or omega-1 knockout eggs (Δω1). (B) Macrophages recruited to SEA or omega-1. (C) Mean macrophage recruitment to omega-1 for each of four experiments. Individual experiments represented with unique symbols; triangles and squares represent means of panels B and D, respectively. (D) Macrophages recruited to omega-1 or DEPC-treated omega-1. (E) Macrophages recruited to WT or RNase mutant omega-1. All omega-1 injections were performed using 0.02 ng of plant-expressed omega-1, with the exception of (E) which used HEK-expressed WT or mutant omega-1 injected at a 5-fold higher concentration of 0.1 ng to compensate for lack of LeX glycosylation in plant-expressed and natural omega-1. Statistics, ANOVA with Dunnett’s post-test comparing all samples to PBS (B) or WT (A,E); (D) non-parametric ANOVA with Dunn’s post-test comparing all samples to omega-1; (C) paired t-test. All horizontal bars, means. Statistics; * p<0.05, ** p<0.01, and *** p<0.001. Omega-1 recruits macrophages via its RNase activity.

Next, we asked if omega-1-associated recruitment of macrophages is dependent on its RNase activity. The inhibition of RNase activity in the recombinant omega-1 with diethyl pyrocarbonate (DEPC) [30], led to loss of macrophage-recruiting activity (Fig 2D ). Because DEPC inhibits RNase function through covalent binding to the essential histidine in the catalytic domain, one caveat is that it can create off-target modifications to the protein structure and function through binding to other histidine residues as well as, to a lesser extent, tyrosine, lysine, and cysteine [37]. To validate our findings, we used recombinant omega-1 mutant lacking RNase activity, with a phenylalanine substitution of the essential histidine of the catalytic domain [21,38]. As expected, the omega-1 mutant failed to recruit macrophages (Fig 2E). These findings confirmed that the omega-1 macrophage chemotactic activity is mediated through its RNase activity (Fig 2B).

Discussion

This study reinforces the use of the zebrafish model to study molecular pathways involved in S. mansoni egg-induced granuloma formation. Particularly, it provides new insights on host and parasite factors modulating this critical process that drives the pathology associated with schistosomiasis.

We demonstrate that the cytokine TNF is required for granuloma enlargement but not initiation, in agreement with previous observations in the mouse [1315,39]. Further, we show that TNF is dispensable for the first wave of macrophage recruitment to the egg. These findings are consistent with TNF not being a direct chemotactic agent, but mediating cell recruitment through interactions with other cells that, in turn, synthesize macrophage chemokines [40,41]. SEA is known to induce the expression of TNF [14,26,42], therefore, we reason that it might be only after granuloma initiation, at which point significant numbers of macrophages are in contact with the egg, that TNF is produced above the threshold to induce these chemokines. In addition, the close cell-to-cell contacts following the initiation of granuloma formation and epithelioid transformation may be vital; if TNF is acting in both an autocrine and paracrine manner, then the cell-to-cell interaction would allow for maximal signal exchange between cells, the optimal amplification of this signal and subsequent expression of chemokines [43,44]. Epithelioid transformation is primarily associated with Th2-polarized immune responses involving IL-4/IL-13, expression of which can occur in the context of innate immunity alone [42,4547]. Therefore, it is not surprising to observe epithelioid transformation in the absence of TNF. Chronic mTORC1 signaling, which does not require adaptive immunity, can also induce epithelioid transformation [48].

We have recently shown that S. mansoni eggs, upon reaching maturity, induce granuloma formation that benefits the parasite by extruding the egg into the environment [4]. This would be achieved by mature egg stage-dependent secretion of antigens such as omega-1 [7,11]. Here, we show that recombinant omega-1 recruited macrophages rapidly, similar to SEA. Our finding supports the hypothesis that omega-1 is sufficient yet dispensable for early macrophage recruitment. This may have parallels in observations regarding its role in granuloma formation; omega-1 knockdown eggs form granulomas in the mouse, albeit smaller ones, suggesting other egg antigens such as IPSE could contribute to this process [16,17].

In addition, we have demonstrated that the omega-1 RNase activity is required for macrophage recruitment. This finding indicates that omega-1 does not act directly as a chemoattractant, and that recruitment must be mediated through downstream effects stemming from its RNase activity. Prior work has shown that its RNase activity mediates Th2 polarization through inhibition of protein synthesis in dendritic cells [21,22,30]. In the context of the 6-hour recruitment assay performed herein, we speculate that the protein is taken up by epithelial cells that line the hindbrain ventricle cavity, perturbing cellular homeostasis by an RNase-induced inhibition of protein synthesis and in turn, inducing cell stress signals which would trigger macrophage recruitment.

As for tuberculous granulomas [47,49], we expect this report will stimulate the use of this facile model to dissect mechanisms underlying the genesis of schistosome egg-induced granulomas, the main drivers of schistosomiasis pathogenesis and transmission.

References

McManusDP, DunneDW, SackoM, UtzingerJ, VennervaldBJ, ZhouXN. Schistosomiasis. Nat Rev Dis Primers. 2018;4(1):13 doi: 10.1038/s41572-018-0013-8 .

CheeverAW, LenziJA, LenziHL, AndradeZA. Experimental models of Schistosoma mansoni infection. Mem Inst Oswaldo Cruz. 2002;97(7):91740. doi: 10.1590/s0074-02762002000700002 .

HutchisonHS. The Pathology of Bilharziasis. Am J Pathol. 1928;4(1):116 1.

TakakiKK, RinaldiG, BerrimanM, PaganAJ, RamakrishnanL. Schistosoma mansoni Eggs Modulate the Timing of Granuloma Formation to Promote Transmission. Cell Host Microbe. 2020 doi: 10.1016/j.chom.2020.10.002 .

TakakiK, DavisJM, WingleeK, RamakrishnanL. Evaluation of the pathogenesis and treatment of Mycobacterium marinum infection in zebrafish. Nat Protoc. 2013;8(6):111424. doi: 10.1038/nprot.2013.068

DavisJM, ClayH, LewisJL, GhoriN, HerbomelP, RamakrishnanL. Real-time visualization of mycobacterium-macrophage interactions leading to initiation of granuloma formation in zebrafish embryos. Immunity. 2002;17(6):693702. doi: 10.1016/s1074-7613(02)00475-2 .

AshtonPD, HarropR, ShahB, WilsonRA. The schistosome egg: development and secretions. Parasitology. 2001;122(Pt 3):32938. doi: 10.1017/s0031182001007351 .

JurbergAD, GoncalvesT, CostaTA, de MattosAC, PascarelliBM, de MansoPP, et al The embryonic development of Schistosoma mansoni eggs: proposal for a new staging system. Dev Genes Evol. 2009;219(5):21934. doi: 10.1007/s00427-009-0285-9 .

ChiuBC, ChensueSW. Chemokine responses in schistosomal antigen-elicited granuloma formation. Parasite Immunol. 2002;24(6):28594. doi: 10.1046/j.1365-3024.2002.00466.x .

10 

BorosDL, WarrenKS. Delayed hypersensitivity-type granuloma formation and dermal reaction induced and elicited by a soluble factor isolated from Schistosoma mansoni eggs. J Exp Med. 1970;132(3):488507. doi: 10.1084/jem.132.3.488

11 

SchrammG, GronowA, KnoblochJ, WipperstegV, GreveldingCG, GalleJ, et al IPSE/alpha-1: a major immunogenic component secreted from Schistosoma mansoni eggs. Mol Biochem Parasitol. 2006;147(1):919. doi: 10.1016/j.molbiopara.2006.01.003 .

12 

Lichtenberg. Studies on Granuloma Formation. Iii. Antigen Sequestration and Destruction in the Schistosome Pseudotubercle. Am J Pathol. 1964;45:7594.

13 

AmiriP, LocksleyRM, ParslowTG, SadickM, RectorE, RitterD, et al Tumour necrosis factor alpha restores granulomas and induces parasite egg-laying in schistosome-infected SCID mice. Nature. 1992;356(6370):6047. doi: 10.1038/356604a0 .

14 

ChensueSW, WarmingtonK, RuthJ, LincolnP, KuoMC, KunkelSL. Cytokine responses during mycobacterial and schistosomal antigen-induced pulmonary granuloma formation. Production of Th1 and Th2 cytokines and relative contribution of tumor necrosis factor. Am J Pathol. 1994;145(5):110513.

15 

ChensueSW, WarmingtonKS, RuthJH, LincolnP, KunkelSL. Cytokine function during mycobacterial and schistosomal antigen-induced pulmonary granuloma formation. Local and regional participation of IFN-gamma, IL-10, and TNF. J Immunol. 1995;154(11):596976. .

16 

HagenJ, YoungND, EveryAL, PagelCN, SchnoellerC, ScheerlinckJP, et al Omega-1 knockdown in Schistosoma mansoni eggs by lentivirus transduction reduces granuloma size in vivo. Nat Commun. 2014;5:5375 doi: 10.1038/ncomms6375

17 

IttiprasertW, MannVH, KarinshakSE, CoghlanA, RinaldiG, SankaranarayananG, et al Programmed genome editing of the omega-1 ribonuclease of the blood fluke, Schistosoma mansoni. Elife. 2019;8 doi: 10.7554/eLife.41337

18 

RocaFJ, RamakrishnanL. TNF dually mediates resistance and susceptibility to mycobacteria via mitochondrial reactive oxygen species. Cell. 2013;153(3):52134. doi: 10.1016/j.cell.2013.03.022

19 

SchrammG, SuwandiA, GaleevA, SharmaS, BraunJ, ClaesAK, et al Schistosome Eggs Impair Protective Th1/Th17 Immune Responses Against Salmonella Infection. Front Immunol. 2018;9:2614 doi: 10.3389/fimmu.2018.02614

20 

WilbersRH, WesterhofLB, van NoortK, ObiegloK, DriessenNN, EvertsB, et al Production and glyco-engineering of immunomodulatory helminth glycoproteins in plants. Sci Rep. 2017;7:45910 doi: 10.1038/srep45910

21 

EvertsB, HussaartsL, DriessenNN, MeevissenMH, SchrammG, van der HamAJ, et al Schistosome-derived omega-1 drives Th2 polarization by suppressing protein synthesis following internalization by the mannose receptor. J Exp Med. 2012;209(10):1753–67, S1. doi: 10.1084/jem.20111381

22 

EvertsB, Perona-WrightG, SmitsHH, HokkeCH, van der HamAJ, FitzsimmonsCM, et al Omega-1, a glycoprotein secreted by Schistosoma mansoni eggs, drives Th2 responses. J Exp Med. 2009;206(8):167380. doi: 10.1084/jem.20082460

23 

PaganAJ, YangCT, CameronJ, SwaimLE, EllettF, LieschkeGJ, et al Myeloid Growth Factors Promote Resistance to Mycobacterial Infection by Curtailing Granuloma Necrosis through Macrophage Replenishment. Cell Host Microbe. 2015;18(1):1526. doi: 10.1016/j.chom.2015.06.008

24 

DaviesSJ, LimKC, BlankRB, KimJH, LucasKD, HernandezDC, et al Involvement of TNF in limiting liver pathology and promoting parasite survival during schistosome infection. Int J Parasitol. 2004;34(1):2736. doi: 10.1016/j.ijpara.2003.10.010

25 

CheeverAW, PoindexterRW, WynnTA. Egg laying is delayed but worm fecundity is normal in SCID mice infected with Schistosoma japonicum and S. mansoni with or without recombinant tumor necrosis factor alpha treatment. Infect Immun. 1999;67(5):22018. doi: 10.1128/IAI.67.5.2201-2208.1999

26 

NascimentoM, HuangSC, SmithA, EvertsB, LamW, BassityE, et al Ly6Chi monocyte recruitment is responsible for Th2 associated host-protective macrophage accumulation in liver inflammation due to schistosomiasis. PLoS Pathog. 2014;10(8):e1004282 doi: 10.1371/journal.ppat.1004282

27 

ClayH, VolkmanHE, RamakrishnanL. Tumor necrosis factor signaling mediates resistance to mycobacteria by inhibiting bacterial growth and macrophage death. Immunity. 2008;29(2):28394. doi: 10.1016/j.immuni.2008.06.011

28 

DunneDW, LucasS, BickleQ, PearsonS, MadgwickL, BainJ, et al Identification and partial purification of an antigen (omega 1) from Schistosoma mansoni eggs which is putatively hepatotoxic in T-cell deprived mice. Trans R Soc Trop Med Hyg. 1981;75(1):5471. doi: 10.1016/0035-9203(81)90013-4 .

29 

CassCL, JohnsonJR, CaliffLL, XuT, HernandezHJ, StadeckerMJ, et al Proteomic analysis of Schistosoma mansoni egg secretions. Mol Biochem Parasitol. 2007;155(2):8493. doi: 10.1016/j.molbiopara.2007.06.002

30 

SteinfelderS, AndersenJF, CannonsJL, FengCG, JoshiM, DwyerD, et al The major component in schistosome eggs responsible for conditioning dendritic cells for Th2 polarization is a T2 ribonuclease (omega-1). J Exp Med. 2009;206(8):168190. doi: 10.1084/jem.20082462

31 

FitzsimmonsCM, SchrammG, JonesFM, ChalmersIW, HoffmannKF, GreveldingCG, et al Molecular characterization of omega-1: a hepatotoxic ribonuclease from Schistosoma mansoni eggs. Mol Biochem Parasitol. 2005;144(1):1237. doi: 10.1016/j.molbiopara.2005.08.003 .

32 

JankovicD, KullbergMC, Noben-TrauthN, CasparP, WardJM, CheeverAW, et al Schistosome-infected IL-4 receptor knockout (KO) mice, in contrast to IL-4 KO mice, fail to develop granulomatous pathology while maintaining the same lymphokine expression profile. J Immunol. 1999;163(1):33742. .

33 

FallonPG, RichardsonEJ, McKenzieGJ, McKenzieAN. Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for IL-4 and IL-13: IL-13 is a profibrotic agent. J Immunol. 2000;164(5):258591. doi: 10.4049/jimmunol.164.5.2585 .

34 

DunneDW, JonesFM, DoenhoffMJ. The purification, characterization, serological activity and hepatotoxic properties of two cationic glycoproteins (alpha 1 and omega 1) from Schistosoma mansoni eggs. Parasitology. 1991;103 Pt 2:22536. doi: 10.1017/s0031182000059503 .

35 

AbdullaMH, LimKC, McKerrowJH, CaffreyCR. Proteomic identification of IPSE/alpha-1 as a major hepatotoxin secreted by Schistosoma mansoni eggs. PLoS Negl Trop Dis. 2011;5(10):e1368 doi: 10.1371/journal.pntd.0001368

36 

KaisarMMM, RitterM, Del FresnoC, JonasdottirHS, van der HamAJ, PelgromLR, et al Dectin-1/2-induced autocrine PGE2 signaling licenses dendritic cells to prime Th2 responses. PLoS Biol. 2018;16(4):e2005504 doi: 10.1371/journal.pbio.2005504

37 

WolfB, LesnawJA, ReichmannME. A mechanism of the irreversible inactivation of bovine pancreatic ribonuclease by diethylpyrocarbonate. A general reaction of diethylpyrocarbonate. A general reaction of diethylpyrocarbonate with proteins. Eur J Biochem. 1970;13(3):51925. doi: 10.1111/j.1432-1033.1970.tb00955.x .

38 

IrieM, OhgiK. Ribonuclease T2. Methods Enzymol. 2001;341:4255. doi: 10.1016/s0076-6879(01)41144-x .

39 

EhlersS, SchaibleUE. The granuloma in tuberculosis: dynamics of a host-pathogen collusion. Front Immunol. 2012;3:411 doi: 10.3389/fimmu.2012.00411

40 

KallioliasGD, IvashkivLB. TNF biology, pathogenic mechanisms and emerging therapeutic strategies. Nat Rev Rheumatol. 2016;12(1):4962. doi: 10.1038/nrrheum.2015.169

41 

MukaidaN, SasakkiS, PopivanovaBK. Tumor Necrosis Factor (TNF) and Chemokines in Colitis-Associated Cancer. Cancers (Basel). 2011;3(3):281126. doi: 10.3390/cancers3032811

42 

ChiuBC, FreemanCM, StolbergVR, HuJS, KomunieckiE, ChensueSW. The innate pulmonary granuloma: characterization and demonstration of dendritic cell recruitment and function. Am J Pathol. 2004;164(3):102130. doi: 10.1016/S0002-9440(10)63189-6

43 

BlasiE, PitzurraL, BartoliA, PulitiM, BistoniF. Tumor necrosis factor as an autocrine and paracrine signal controlling the macrophage secretory response to Candida albicans. Infect Immun. 1994;62(4):1199206. doi: 10.1128/IAI.62.4.1199-1206.1994

44 

CaldwellAB, ChengZ, VargasJD, BirnbaumHA, HoffmannA. Network dynamics determine the autocrine and paracrine signaling functions of TNF. Genes Dev. 2014;28(19):212033. doi: 10.1101/gad.244749.114

45 

BottiglioneF, DeeCT, LeaR, ZeefLAH, BadrockAP, WaneM, et al Zebrafish IL-4-like Cytokines and IL-10 Suppress Inflammation but Only IL-10 Is Essential for Gill Homeostasis. J Immunol. 2020;205(4):9941008. doi: 10.4049/jimmunol.2000372

46 

MitreE, TaylorRT, KubofcikJ, NutmanTB. Parasite antigen-driven basophils are a major source of IL-4 in human filarial infections. J Immunol. 2004;172(4):243945. doi: 10.4049/jimmunol.172.4.2439 .

47 

PaganAJ, RamakrishnanL. The Formation and Function of Granulomas. Annu Rev Immunol. 2018;36:63965. doi: 10.1146/annurev-immunol-032712-100022 .

48 

LinkeM, PhamHT, KatholnigK, SchnollerT, MillerA, DemelF, et al Chronic signaling via the metabolic checkpoint kinase mTORC1 induces macrophage granuloma formation and marks sarcoidosis progression. Nat Immunol. 2017;18(3):293302. doi: 10.1038/ni.3655

49 

RamakrishnanL. Revisiting the role of the granuloma in tuberculosis. Nat Rev Immunol. 2012;12(5):35266. doi: 10.1038/nri3211 .

18 Oct 2020

Dear Ramakrishnan,

Thank you very much for submitting your manuscript "Tumor Necrosis Factor and Schistosoma mansoni egg antigen Omega-1 shape distinct aspects of the early egg-induced granulomatous response" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations, particularly those of Reviewer 2.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.  

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript. 

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

John Pius Dalton, PhD

Associate Editor

PLOS Neglected Tropical Diseases

Sergio Costa Oliveira

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: (No Response)

Reviewer #2: This manuscript uses a new model system for schistosome research in zebrafish. The full model is described in a recently accepted paper, and this manuscript describes some additional studies of the role of TNF and Omega-1 in granulomatous responses. Although the two parts of the paper both have a good rationale, they do appear quite separate, and do not link together well as a single study.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: (No Response)

Reviewer #2: Results are presented well and described in a complete and clear manner.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: The paper is very well written, and for the most part conclusions are backed up by the data. One exception is the statement "we speculate that the protein is taken up by epithelial cells that line the hindbrain ventricle cavity, perturbing cellular homeostasis by an RNase-induced inhibition of protein synthesis and in turn, inducing cell stress signals which would trigger macrophage recruitment" - as indicated this is highly speculative and is not backed up by any data. It is a valid hypothesis and this paper would be much improved by producing some data to support this hypothesis.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: This is a short but interesting paper, presenting the use of a novel animal platform to explore a protein released by schistosome eggs driving the formation of granuloma and more specifically macrophage recruitment.

There is a large amount of background in the Results section which needs to be moved to the introduction or discussion.

The reference to an accepted paper (Takaki et al., 2020)(Cell Host & Microbe, accepted) is problematic and impossible to review, while some efforts have been to demonstrated key points (fig s1).

In Figure 2D in omega-1 samples the two outlier significantly increase the average of this condition, what do the authors think of these samples, since this is not seen in 2B?

The importance of RNase activity in mac recruitment is clearly shown in DEPC treatment.

The authors mention that a omega1 KO shipments wasn’t viable so they performed some other experiments, and then they had another shipment which is shown in 2e? This is not clear.

The authors comment about RNase activity with their samples, but what about cytotoxity against zebra fish cells specifically? This is important since O-1 is a major hepatotoxin. Does DEPC treat eliminated cytotoxicity also?

Reviewer #2: This study uses an important and novel new model to confirm some previous findings in mice. It contains some interesting data, however their novelty is limited by the fact that both findings (the role of TNF and Omega-1 in granuloma formation) have previously been tested in mice. Furthermore, the two parts of the manuscript did not lead naturally on from one another and it appeared to be two separate studies.

Major comment:

Further work should be carried out to determine the mechanistic basis of RNAse-dependent macrophage recruitment to Omega-1. The authors propose a mechanism through epithelial cells - data should be provided to either back up this claim, or alternatively, Omega-1 could be acting directly on macrophages - the authors could address this by using WT or RNAse-deficient Omega-1 and assess whether either proteins induce isolated (human, mouse or fish) macrophage chemotaxis in vitro.

Minor comment:

Page 10: "The omega-1 deficient SEA retains ~20% of the omega-1 RNase activity (not shown), suggesting that even though reduced compared to wild type eggs, it is may still be sufficient for macrophage recruitment (Ittiprasert et al., 2019)." This statement should be clarified - does the knockdown only reduce Omega-1 expression by 80% or is there RNAse activity from some other source?

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr Henry J McSorley

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plosntds/s/submission-guidelines#loc-materials-and-methods


30 Oct 2020

Submitted filename: Reviewer Responses.docx

17 Nov 2020

Dear Sergio Costa Oliveira,

We are pleased to inform you that your manuscript 'Tumor Necrosis Factor and Schistosoma mansoni egg antigen Omega-1 shape distinct aspects of the early egg-induced granulomatous response' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

John Pius Dalton, PhD

Associate Editor

PLOS Neglected Tropical Diseases

Sergio Costa Oliveira

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #2: (No Response)

**********

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #2: (No Response)

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #2: (No Response)

**********

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #2: (No Response)

**********

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #2: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Dr Henry J McSorley


12 Jan 2021

Dear Professor Ramakrishnan,

We are delighted to inform you that your manuscript, "Tumor Necrosis Factor and Schistosoma mansoni egg antigen Omega-1 shape distinct aspects of the early egg-induced granulomatous response," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

https://www.researchpad.co/tools/openurl?pubtype=article&doi=10.1371/journal.pntd.0008814&title=Tumor Necrosis Factor and <i>Schistosoma mansoni</i> egg antigen omega-1 shape distinct aspects of the early egg-induced granulomatous response&author=&keyword=&subject=Research Article,Biology and Life Sciences,Cell Biology,Cellular Types,Animal Cells,Blood Cells,White Blood Cells,Macrophages,Biology and Life Sciences,Cell Biology,Cellular Types,Animal Cells,Immune Cells,White Blood Cells,Macrophages,Biology and Life Sciences,Immunology,Immune Cells,White Blood Cells,Macrophages,Medicine and Health Sciences,Immunology,Immune Cells,White Blood Cells,Macrophages,Biology and Life Sciences,Cell Biology,Cellular Types,Animal Cells,Immune Cells,Granulomas,Biology and Life Sciences,Immunology,Immune Cells,Granulomas,Medicine and Health Sciences,Immunology,Immune Cells,Granulomas,Biology and Life Sciences,Physiology,Reproductive Physiology,Eggs,Research and Analysis Methods,Animal Studies,Experimental Organism Systems,Model Organisms,Zebrafish,Research and Analysis Methods,Model Organisms,Zebrafish,Research and Analysis Methods,Animal Studies,Experimental Organism Systems,Animal Models,Zebrafish,Biology and Life Sciences,Organisms,Eukaryota,Animals,Vertebrates,Fish,Osteichthyes,Zebrafish,Biology and Life Sciences,Zoology,Animals,Vertebrates,Fish,Osteichthyes,Zebrafish,Biology and Life Sciences,Organisms,Eukaryota,Animals,Invertebrates,Helminths,Schistosoma,Schistosoma Mansoni,Biology and Life Sciences,Zoology,Animals,Invertebrates,Helminths,Schistosoma,Schistosoma Mansoni,Biology and life sciences,Biochemistry,Proteins,DNA-binding proteins,Nucleases,Ribonucleases,Biology and Life Sciences,Biochemistry,Enzymology,Enzymes,Hydrolases,Nucleases,Ribonucleases,Biology and Life Sciences,Biochemistry,Proteins,Enzymes,Hydrolases,Nucleases,Ribonucleases,Biology and Life Sciences,Physiology,Immune Physiology,Cytokines,Biology and Life Sciences,Immunology,Immune System,Innate Immune System,Cytokines,Medicine and Health Sciences,Immunology,Immune System,Innate Immune System,Cytokines,Biology and Life Sciences,Developmental Biology,Molecular Development,Cytokines,Biology and Life Sciences,Anatomy,Brain,Hindbrain,Medicine and Health Sciences,Anatomy,Brain,Hindbrain,