PLoS Neglected Tropical Diseases
image
High endemicity of alveolar echinococcosis in Yili Prefecture, Xinjiang Autonomous Region, the People’s Republic of China: Infection status in different ethnic communities and in small mammals
DOI 10.1371/journal.pntd.0008891 , Volume: 15 , Issue: 1
Article Type: research-article, Article History
Abstract

Alveolar echinococcosis (AE) is a neglected zoonosis caused by the larval stage of the fox/dog tapeworm Echinococcus multilocularis. In this study, we collected data on 286 AE cases reported from Yili Prefecture, Xinjiang Autonomous Region, the People’s Republic of China from 1989 to 2015 with an annual incidence (AI) of 0.41/100,000. Among the patients, 73.08% were diagnosed in the last 11 years. The incidence (0.51–1.22 cases/100,000 residents) was higher in the high-altitude mountainous areas than those in low level areas (0.19–0.29/100,000 residents). In term of ethnic group, the AI of AE in Mongolian (2.06/100,000 residents) and Kazak (0.93/100,000) groups had higher incidence than the other ethnic groups, indicating sheep-farming activity is a risk for infection given that sheep farming is mainly practiced by these two groups in the prefecture. A total of 1411 small mammals were captured with 9.14% infected with E. multilocularis metacestodes. Microtus obscurus was the dominant species captured in the mountainous pasture areas with 15.01% infection rate, whereas Mus musculus and Apodemus sylvaticus were the dominant small mammals in the low altitude areas. Only 0.40% of A. sylvaticus were infected with E. multilocularis. These findings show that Yili Prefecture is a highly endemic area for AE and that the high-altitude pasture areas favorable for M. obscurus may play an important role in its transmission in this region.

Guo, Zhang, Guo, Guo, Wang, Ma, Chen, Zheng, Bao, He, Wang, Qi, Tian, Wang, Zhou, Giraudoux, Marston, McManus, Zhang, Li, and Torgerson: High endemicity of alveolar echinococcosis in Yili Prefecture, Xinjiang Autonomous Region, the People’s Republic of China: Infection status in different ethnic communities and in small mammals

Introduction

Echinococcus multilocularis infection causes alveolar echinococcosis (AE) in humans. This lethal disease is endemic in the Northern Hemisphere [1,2] with a median of 666,434 DALYs (disability-adjusted life years) per annum resulting [3]. The life-cycle of E. multilocularis involves two kinds of mammalian host species, intermediate hosts including small mammals such as Microtus rodents, and canid definitive hosts including foxes (Vulpes vulpes), dogs (Canis familiaris), and the raccoon dog (Nyctereutes procyonoides ) [4]. Definitive hosts are infected by predating small mammals that harbor E. multilocularis metacestodes containing protoscoleces (PSCs). Approximately 30 days post-infection, the PSCs develop into mature tapeworms producing eggs in the intestine of the definitive host [5]. The eggs are released into the environment in the feces of the definitive hosts, and subsequently infect small mammals via oral ingestion when feeding on vegetation. Thus, E. multilocularis transmission typically occurs in a cycle between foxes/dogs and small mammals [2]; humans can also be infected, although they are accidental hosts not directly involved in the life-cycle of the parasite [1].

In the People’s Republic of China, AE is highly endemic, particularly on the Qinghai-Tibet Plateau [3,4,69]; Kazakhstan and Kyrgyzstan are also highly endemic for the disease [3]. Xinjiang Autonomous Region bridges these two endemic areas and is, historically, an AE-endemic area [10]. However, the recent endemic situation in this region is unclear, with no updated reports since 2000 [10]. In this study, we retrospectively collected human AE cases from eight counties and one city in Yili Prefecture, which shows that AE incidence increased over the 20 year period. Our surveys of E. multilocularis infection in small mammals indicated that Yili Prefecture is a natural focus of E. multilocularis, and the resulting AE cases in human communities from this region may be associated with the distribution of Microtus spp. small mammals and animal farming activity.

Materials and methods

Ethics statement

This study, including the capture of wild small mammals during field survey, was approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University, Urumqi, China (approval number 20140619–12). All patients involved in the study also provided their written informed consent including child patients with the written informed consents from their parents/guardians.

Study area

Yili Prefecture is located in the west Tianshan Mountains in Xinjiang Autonomous Region, The People’s Republic of China, bordering Kazakhstan. The prefecture has eight counties and one city, Yining City, and is traversed by the Yili River which is itself formed by the convergence of three main upstream rivers, the Kashi River, Kunus River and Tekes River (Fig 1). There are five counties in the high altitude mountainous pasture area (HAPA) in the upstream regions of the Yili River, these being Nileke, Xinyuan, Gongliu, Tekes and Zhaosu Counties. Yining City and Yining, Chabuchaer and Huocheng counties are located downstream in the low altitude mountainous agricultural area (LAAA) of the Yili River. In 2015, Yili Prefecture (8 counties and 1 city) had a total population of 2.69 million with the major ethnic groups being Kazak, Han, Uygur, Hui/Dongxiang, Mongol, Xibo and Uzbek. In the HAPA there are approximately 20 million hectares pasture areas higher than 1800 meters above sea level that are utilized for farming, supporting a total of 6.688 million domestic animals including sheep, cattle and horses [11]. The annual average temperature in the HAPA is 2.9–5.9°C with an average rainfall of 600 mm. The down-stream LAAA region comprises 0.49 million hectares of farmland with an annual average temperature of 9.1–11.1°C and annual average rainfall of 417.6 mm.

Distribution of alveolar echinococcosis cases in Yili Prefecture, Xinjiang.
Fig 1
In the figure, “green” indicates grassland, “white” indicates agricultural land, “yellow” indicates the city name and location, “cross” indicates the sampling site, and “blue curve” indicates a river. Cumulative incidences in each of the counties are also indicated.Distribution of alveolar echinococcosis cases in Yili Prefecture, Xinjiang.

Data collection and analysis in Yili Prefecture

All AE cases reported in this study were registered in four hospitals with approved surgical teams and facilities for treating this disease. These are the Yili Friendship Hospital, Xinhua Hospital, Nongsishi Hospital and the First Affiliated Hospital of Xinjiang Medical University. These are the only hospitals/clinics for treating AE in this region. The duration period of the study was from 1989 (the time of the first confirmed case) to 2015. All AE patients were diagnosed by radiology, serology, and/or pathological testing of tissue sections following surgical removal of lesions, and all cases were treated with albendazole. A state-driven control program was commenced in 2005 [2]. An average annual incidence (AI) was calculated based on cumulative incidence [12] for comparison of AE infectious status over two periods (1994–2004 and 2005–2015) in Yili Prefecture. We collected population statistics from the Sixth National Census [http://blog.sina.com.cn/s/blog_4b0a5e8a0101cc2o.html] and Yili Annual Reports (YILIHASAKEZIZHIZHOU TONGJINIANJIAN) from 1999 to 2015, as released by the Yili Bureau of Statistics.

Small mammal collection and E. multilocularis detection

Three counties were selected for small mammal sampling in the HAPA (Nileke, Xinyuan and Tekes Counties) with one further county, Chabuchaer County, selected in the LAAA. In each selected HAPA county, two different locations were selected (Fig 1). To capture small mammals in the HAPA locations, water was pumped into burrows to drive out the small mammals, which were subsequently captured. In Chabuchaer County, small mammals were captured using trapping methods [13]. Snap traps 10×15 cm in size were placed linearly along the edge of agricultural farmland with 10 meter intervals between traps. Over a period of 3 weeks in August/September, 2017, 200 traps were laid each afternoon and these were collected on the afternoon of the following day.

The livers of the captured small mammals were visually inspected for E. multilocularis metacestodes by three staff members. Suspected infected livers displaying white dots, or cyst like lesions or tissues with unusual surface appearances, were fixed with 75% (v/v) ethanol and stored at 4°C until parasite and small mammal identification was undertaken. Non-Microtus species were identified by morphological characteristics.

Haematoxylin and eosin (H&E) staining

All small mammal livers suspected of AE infection were sectioned for histological examination. Twenty non-infected livers were sectioned and stained as negative controls. Each liver was cut into three sections and dehydrated using a Leica automatic dehydrator. The specimens were embedded into paraffin blocks and cut into 3-μm thick sections which were placed on glass slides. These sections were stained with H&E for pathological investigation using a Leica microscope. The characteristic features of E. multilocularis metacestode infection include the presence of PSCs, laminated and germinal layers, and host cell infiltration.

DNA extraction

Genomic DNA was extracted from each sample of 75% ethanol-fixed liver using TIANGEN TIANamp Genomic DNA kits (TIANGEN BOITECH, Beijing, China) according to the manufacturer’s instructions. DNA was eluted with 2×50 μl RNase free-water by centrifugation of the applied column at 12,000 rpm for 2 minutes, and the extracted DNA was stored at -20°C until use. Nested-PCR and sequencing for identifying E. multilocularis and Microtus species were performed according to established methods [1416]; primers used are listed in Table 1. In brief, 2 μl of each extracted DNA sample was added to a PCR tube containing 25 μl mixture comprising 2 primers and 21 μl H2O. The reaction conditions comprised initial denaturation at 94°C for 3 min, and then 35 cycles of 94°C for 1 min, 56°C for 1 min and 72°C for 2 min with the last extension at 72°C for 10 min. The PCR products were sent to BGI (Shenzhen, China) for sequencing. Bioedit (http://www.mbio.ncsu.edu/bioedit/bioedit.html) was used to compare the obtained sequences with sequences in GenBank.

Table 1
Primers designed for amplification of the partial sequences of E. multilocularis cox1, nad2 and cob genes using nested PCR.
PrimerSequence (5′-3′) (First amplification)Sequence (5′-3′) (Second amplification)
cox1-FGTGGTGTTGATTTTTTGATGTTTAGCAGGTGTTTCTAGAGTTTTTAGT
cox1-RCCAAACGTAAACAACACTATAAAAGAACCCACCACAAAATAGGATCACT
nad2-FGTTGAGCTATGTAATAATGTGTGGATGCGTTGATTCATTGATACATTG
nad2-RAAATCTGTTGAATCTGCTACAACCTAGTAAAGCTCAAACCGAGTTCT
cob-FGGGTATGGCTTTGTATTATGGTAGTTGTTTAAACTGGTAGATTGTGGTTC
cob-RATCACTCAGGCTTAATACTAACAGGAGCTCCACAGTAGAAATCACCATCA

Statistical analysis

The Chi-Square test was used to compare the differences in AE prevalence/incidence over time and between counties and ethnic groups.

Results

High AE incidence from pasture areas in Yili Prefecture

The first AE case in our data set was identified in 1989 in Yili Friendship Hospital. By 2015, a total of 286 cases were diagnosed and registered in Yili Prefecture with an average annual incidence (AI) of 0.41/100,000 residents (Table 2). From 2005 to 2015, the AI was 0.70/100,000 (209 cases/2,690,960 residents (2015)), which was 3.04 times of the AI in the first period from 1994 to 2004 (0.23/100,000). We found 73.08% (209/286) of these patients had been diagnosed from 2005 to 2015 (Fig 2). There was a significant difference in incidence between the two periods (p <0.0001). As shown in Fig 2, there is a linear relationship between incidence and time, with the incidence increasing over time (χ2 = 4.403, p <0.05). Of these AE patients, 153 cases were Kazak accounting for 53.50% of the total AE cases, followed by Han (18.88% (54/286)), Uygur (12.24% (35/286)), Hui/DongXiang (8.39% (24/286)), and Mongol (6.29% (18/286)) (Tables 2 and 3). Of the total cases, 150 were males and 136 females; more males than females were infected in all counties except Gongliu County, although the difference was not statistically significant (Table 4).

Distribution of alveolar echinococcosis (AE) cases in Yili Prefecture, Xinjiang.
Fig 2
(a) Number of AE cases since 1989; (b) AE cases in different age groups; (c) AE cases and average annual incidence (AI, cases/100,000) between the high altitude mountainous pasture area (HAPA) and the low altitude mountainous agricultural area (LAAA); (d) AE cases and AI in different ethnic groups. An asterisk indicates a significant difference.Distribution of alveolar echinococcosis (AE) cases in Yili Prefecture, Xinjiang.
Table 2
The cumulative number of cases and the proportion of the population for the different ethnic groups in 2015.
Ethnic groupCasesCases proportion (%)Population proportion (%)
Han5418.8830.36
Kazak15353.5028.26
Uygur3512.2423.28
Hui/Dongxiang188.3911.68
Mongol246.291.23
Xibo20.701.18
Other ethnicities004.01
Table 3
The distribution of AE patients in different ethnic groups.
Ethnic
County
HanKazakUygurHui/DongxiangMongolXiboTotal
Nileke1234338060
Xinyuan833101043
Gongliu310211017
Tekes416050025
Zhaosu331328047
Chabuchaer33440115
Yining13151650150
Huocheng811640029
Total541533524182286
Table 4
Sex distribution of AE patients in the study counties.
Sex
County
MaleFemale
Nileke3525
Xinyuan2221
Gongliu89
Tekes169
Zhaosu2225
Chabuchaer114
Yining2624
Huocheng1613
Total156130

To estimate the risk and incidence of AE infection, we collected population data for Yili Prefecture from census and annual reports. According to the Sixth National Census in 2010 (http://www.xjtj.gov.cn/), the population of Yili Prefecture was 2,397,551. A breakdown of the ethnic groups comprising this overall population in 2015, and the corresponding cumulative number of recorded cases for each group, are shown in Table 2.

To generate ethnic group specific AI rates, the total number of cases recorded for a given ethnic group was divided firstly by the total population of that group in 2015, then, divided by 26 (years), and multiplied by 100,000 to generate a AI measure of AE cases per 100,000 persons. This analysis was performed for each ethnicity and showed that the AI of AE in the Mongolian ethnic group was the highest (2.06/100,000 residents), 5.09 times higher than the average incidence in this area. The second highest risk group was Kazak (0.93/100,000), followed by Hui/Dongxiang (0.29/100,000), Han (0.25/100,000), Uygur (0.18/100,000) and Xibo (0.24/100,000) (Fig 2). Chi-Square analysis showed the differences in the AI between the Han and Kazak and Mongol ethnicities were highly significant (p<0.0001); there was no significant difference in the AI between the Han and Hui/Dongxiang, Uygur and Xibo ethnic groups.

Fig 2 shows that 87.76% of AE cases were young or middle-aged patients (between 16 and 60 years-old) with a peak age of 36–40. The mean and median ages for all AE cases were 41.86 and 46 years, respectively. All these cases were seen by hospital doctors, had pronounced lesion pathology, and were in poor health. Two cases had metastases that had spread into the lungs and two cases had brain metastases. Among all the AE cases, 71.43% had surgical resection immediately after diagnosis whereas the remainder did not undergo surgery due to medical reasons. All patients with AE were treated with albendazole. There were four young patients with one aged 12 (Hui/Dongxiang) and 3 (Kazakhs) aged 15. All were from sheep-farming families from HAPA, indicating that AE patients may have been infected with E. multilocularis at young ages, and that infection was likely associated with their family livelihood (Fig 2).

The AIs of four counties, Nileke, Zhaosu, Xinyuan and Tekes in the HAPA region were 1.22/100,000, 0.96/100,000, 0.51/100,000, and 0.55/100,000, respectively; these were significantly higher than the LAAA counties of Yining, Huocheng and Chabuchaer which had AIs of 0.19/100,000, 0.27/100,000 and 0.29/100,000, respectively (p <0.05) (Fig 2). The difference between Yining County and the four HAPA counties was highly significant (p<0.0001); however, there was no significant difference between Yining County and the other two LAAA counties (p>0.05).

Follow-up of AE patients

Although contact with many of the patients was lost, contact was successfully made with 21 patients or their relatives. Of these cases, 14 were male and 7 were female, 15 were from the HAPA area with 6 from the LAAA area. By the time of being contacted, the youngest individual was 20 with the oldest being 81, with mean and median ages of 49.95 and 44 years respectively. Of these, 15 (15/21, 71.43%) had AE lesions surgically removed and were provided with albendazole treatment. However, 3 (3/15, 20%) of the patients relapsed and died within three years with an average survival time of 1.83 years after surgery. The majority (12/15, 80.00%) of the patients made good progress with an average survival time of 3.17 (2–5) years post-surgery prior to follow-up interviews. Six (28.57%) of the patients did not undergo surgery but were provided with albendazole. However, three died, having an average lifespan of 3.33 years after diagnosis; the median survival time of these 6 AE patients was 3.5 years. One patient had been taking albendazole for 3 years but was in poor health. The AE lesion of another patient was calcified after 5.5 years albendazole treatment and one patient remained in a stable condition for 3 years after taking the medication.

High prevalence of E. multilocularis in small mammals from mountainous pasture areas

A total of 1411 small mammals were captured, of which 129 (9.14%) were infected with E. multilocularis metacestodes (Table 5), confirmed by both H&E staining and DNA sequencing. Through visual checking of 126 Microtus spp suspected liver samples, 122 were confirmed as E. multilocularis-positive by H&E staining with all the H&E positive samples subsequently further confirmed as having E. multilocularis infection by DNA sequencing. The 4 remaining livers were confirmed as negative by H&E staining, and the 20 non-infected control livers checked visually were all PCR-negative.

Table 5
Alveolar echinococcosis in small mammals in Yili Prefecture, Xinjiang.
County
Species
NilekeXinyuanTekesChabuchaerTotal
Positive/ SamplesInfection prevalencePositive/ SamplesInfection prevalencePositive/ SamplesInfection prevalencePositive/ SamplesInfection prevalencePositive/ SamplesInfection prevalence
Mus musculus0000000/23200/2320
Microtus sppa14/1499.40%54/35715.13%54/29118.56%0/16b0122/81315.01%
A. sylvaticus0000001/2490.40%1/2490.40%
R. sopimus0000002/258.00%2/258.00%
M. erythrourus0000002/474.26%2/474.26%
E. trancrei2/20000/20002/450.00%
Others *0000000/4100/410
Total16/15110.60%54/35715.13%54/29318.43%5/6100.83%129/14119.14%
Note: a, including M. obcurus and M. arvailis. b, these 16 Microtus spp were captured from the high-altitude mountainous pasture area.
*Others: R. norvegicus, (n = 29); C. migratorius, (n = 6); M. tamariscinus, (n = 6).

Among the small mammals collected, 813 were Microtus rodents captured in the HAPA including Xinyuan, Tekes and Nileke Counties in the up-stream areas of Yili River. These E. multilocularis positive animals accounted for 15.01% (122/813) of Microtus spp voles infected with E. multilocularis (Table 5). For identification of Microtus species, we PCR-amplified 270 Microtus spp DNA samples including 122 that were infected with E. multilocularis metacestodes. We obtained 159 Microtus spp Cob fragment sequences with the greatest number of sequenced samples originating from E. multilocularis infected animals (accession numbers: MN049933-MN049940, MN049943-MN049947, MN049950-MN049954). The DNA sequence analysis showed that there were two species of Microtus spp present in the study location: 96.23% (153/159) were M. obscurus and 3.77% (6/159) were M. arvalis; 33.59% (52/153) and 33.33% (2/6 of M. obscurus and M. arvalis were, respectively, infected with E. multilocularis. However, only two Microtus spp voles harboured E. multilocularis metacestodes with PSCs present. Four Ellobius tancrei were captured with two (2/4) infected with metacestodes, both with PSCs of E. multilocularis (Fig 3). In Chabuchaer County in the LAAA 594 small mammals were captured; Apodemus sylvaticus (249/594) and Mus musculus (232/594) were predominant. Only one A. sylvaticus (0.40%) was infected with E. multilocularis (Table 5). We found that 2 of 47 Meriones erythrourus, and 2 of 25 Rhombomys opimus were infected with E. multilocularis metacestodes (Table 5). No Mus musculus (n = 232), Rattus norvegicus (n = 29), Cricetulus migratorius (n = 6) or M. tamariscinus (n = 6) (Table 5) were infected with E. multilocularis metacestodes

Haematoxylin and eosin staining showing the characteristic pathological response in alveolar echinococcosis.
Fig 3
(a) E. multilocularis metacestode; (b) Liver section with PSCs, 200× original magnification. Black arrow indicates cystic lesions; red arrow indicates PSCs.Haematoxylin and eosin staining showing the characteristic pathological response in alveolar echinococcosis.

E. multilocularis genotypes

To further confirm the identity of the 129 H&E-positive samples, PCR was used to amplify three gene (cox1, nad2 and cob) fragments of E. multilocularis and then the PCR products were directly sequenced to determine genetic variation among the isolates. A total of 66 isolates produced one or three gene sequences for analysis. The sizes of the amplified DNA fragments were 497 bp, 346 bp and 397 bp for cox1, nad2, and cob, respectively (GenBank accession numbers: cox1:MH211144-MH211159, nad2: MH211160-MH211174 (except to MH211170), cob: MH211175-MH211190).

The DNA sequence analysis showed that the E. multilocularis cox1, nad2 and cob sequences of the isolates from Yili Prefecture were genetically similar to isolates from Central Asia and Europe, indicating a close evolutionary relationship. We amplified 43 copies of the cox1 gene and divided them into 16 haploids (Fig 4A), with XH1 the most common in 21 samples. Distance-based NJ analysis of the cox1 gene sequences showed XH2, XH3, XH13, XH16 were close to the published sequences KT965441 (Ningxia, China) and KT965439 (Xinjiang, China) (Fig 4B). We found that the XH1 sequence was 100% identical to the haplotype reported from Kazakhstan and China (Sichuan Province) [1718]. The other haplotypes detected in 16 isolates in the present study were identical to sequences previously published in GenBank (Table 6). The one predominant (60/97) E. multilocularis Nad 2 haplotype (MH211160) present in the small mammals was identical to the sequence isolated from local human AE cases in a previous study of ours [14] (S1 Fig).

Phylogenetic tree of E. multilocularis mtDNA cox1 gene.
Fig 4
The phylogenetic tree was constructed using the neighbor-joining algorithm of the phylogeny program MEGA 6.0. Bootstrap method via 1000 pseudo replicates was used to assess the reliability of the tree. (a) Sixteen haplotypes identified in this study; (b) Sixteen haplotypes were analyzed with other similar sequences in the phylogenetic tree. XH indicates the cox1 gene haplotype.Phylogenetic tree of E. multilocularis mtDNA cox1 gene.
Table 6
All samples were from small mammal hosts collected during the current study.
E. multilocularis haplotypes characterized by partial cox1 sequences used for phylogenetic analysis.
HaplotypeLocationNumberAccession numberHost
XH1Xinyuan (10), Tekes (5), Nileke (4), Chabuchaer (2)21MH211144Microtus spp, E. trancrei
XH 2Nileke (1)1MH211145Microtus spp
XH 3Tekes (1)1MH211146Microtus spp
XH 4Chabuchaer (1)1MH211147Microtus spp
XH 5Xinyuan (1)1MH211148Microtus spp
XH 6Tekes (1)1MH211149Microtus spp
XH 7Xinyuan (1)1MH211150Microtus spp
XH 8Tekes (1)1MH211151Microtus spp
XH 9Xinyuan (4), Tekes (2)6MH211152Microtus spp
XH 10Xinyuan (1)1MH211153Microtus spp
XH 11Nileke (1)1MH211154Microtus spp
XH 12Xinyuan (1)1MH211155Microtus spp
XH 13Xinyuan (1)1MH211156Microtus spp
XH 14Tekes (1)1MH211157Microtus spp
XH 15Xinyuan (2), Chabuchaer (1)3MH211158Microtus spp
XH 16Xinyuan (1)1MH211159Microtus spp

Discussion

Yili Prefecture is a high endemic area for AE

In this study, we retrospectively collected human AE cases from eight counties and one city in Yili Prefecture, Xinjiang Autonomous Region. The results showed that AE incidence increased over a 20 year period, especially in the last decade, and that the incidence of AE is likely associated with the presence of altitude-associated small mammal species such as Microtus which are the predominant rodents in the pasture areas. In a preliminary study, Zhou et al.[10] reviewed human AE cases in Yili Prefecture and showed that the Yili valley area was an endemic area with a incidence of 3.80 cases/100,000 inhabitants (n = 77 cases), with 10 cases recorded before 1990 [10]. Here, all the AE cases in 4 hospitals were treated by approved teams with specific expertise for surgical treatment of AE; these included 3 hospitals in Yili Prefecture and one in Urumqi (First Affiliated Hospital of Xinjiang Medical University), with records showing the earliest AE case was registered in 1989. We found that a total of 286 AE patients were diagnosed and treated in Yili Prefecture between 1989 and 2015, with more than 200 cases recorded after 2000. It is difficult to obtain true incidence figures by sampling methods in the Yili Prefecture area as the semi-nomadic communities drive their livestock seasonally between summer and winter pastures. Also, given the relatively low abundance of AE, establishing true incidence values requires a large population to be surveyed which is logistically difficult to perform in such remote communities. China commenced control of echinococcosis program in 2005. Cumulative incidence (CI) has been used to compare the endemic picture for AE over two time periods [12] but in this study, we used annual incidence (AI) to compare the endemic situation over two periods of time, i.e. 11 years before commencement of the control program and 11 years after commencement of the control program. The AI more than doubled in the second survey period (2005–2015) compared with the first (1994–2004) with 0.70 cases per 100,000 residents versus 0.23 per 100,000, indicating that Yili Prefecture is both a highly endemic and an emerging area for AE [8,1921]. In the last 10 years, the extensive education program and improvement of diagnostics capability may have impacted on the number of recorded AE cases. However, data from 2011–2015 showed that 20, 20, 33 (a partial mass ultrasound survey was undertaken in 2013), 18 and 17 cases respectively were identified, indicating a levelling trend of AE cases.

Using the AI, this study also showed that the AE incidence in the Kazak population (0.93/100,000) was, respectively, 3.70, 5.31, 3.20 and 3.89 times higher than that in Han, Uygur, Hui/Dongxiang and Xibo groups in Yili Prefecture. Although the overall number of cases in the Mongolian population was low, the AI (2.06/100,000) was the highest of all the ethnic groups, being 8.19, 11.76, 7.09 and 8.62 times higher than the corresponding incidence values for the Han, Uygur, Hui /Dongxiang and Xibo ethnic groups, respectively.

The reasons for the Kazak and Mongol ethnicities presenting with a higher incidence may be due to these groups mainly working with animal production following traditional methods, including moving seasonally in search of pasture for their animal herds [10]. Living in the high-altitude mountain pasture areas from May to the end of September is a major reason why human infection is more likely due to the high numbers of Microtus spp and Ellobius voles infected with E. multilocularis. In these HAPA, sheep dogs rely, at least partly, on feeding on rodents for food, and the high parasite prevalence in these animals likely results in a significant numbers of dogs infected with E. multilocularis. One limitation of the current study is that no prevalence data were available on dog infections with adult E. multilocularis due to the strict bio-safety restrictions operating at the First Affiliated Hospital of Xinjiang Medical University. However, the families of sheep-farmers generally raise one or more sheepdogs at any particular time, and these dogs likely play an important role in the transmission of AE to humans.

Age group analysis showed the peak age group for human E. multilocularis infection was 36 to 40 years, with 77.27% of the AE patients being in the broad age range of 21–55. There is normally a 5–15 year period between initial infection and patients beginning to exhibit symptoms with AE [22]; therefore it is likely that AE patients aged 30–40 became infected when they were 15–30 years old. In this study, the youngest patient was 11 years old, suggesting the child had been infected early on in life.

Treatment and follow-up

Most of the AE patients revealed in this study only visited hospitals and were diagnosed by clinicians in the later stages of the disease. For these AE patients, surgically removing lesions is the first option for treatment. Although we could not follow-up all the patients, more than half were in a stable condition following surgery and albendazole treatment. One patient had stopped taking albendazole. For those patients who did not undergo surgery, more than half died within 1–3 years, even when receiving albendazole treatment. It is reported long-term treatment with albendazole has improved the 10-year survival rate of AE patients compared with untreated historical controls from 6–25% to 80–83% [2327]. It has also been suggested that the majority of AE cases can recover after surgery [2], while the majority of patients not having surgery die or have a poor prognosis.

Yili Prefecture is a natural focus of AE

This study confirms Yili Prefecture as a natural focus of AE and demonstrates that Microtus spp and Ellobius voles harbor high levels of infection with E. multilocularis. Small mammal species include M. obscurus and M. arvalis, E. trancrei in the HAPA, and Mus musculus, R. norvegicus, A. sylvaticus, M. erythrourus and R. opimus in the LAAA. However, Microtus spp were by far the dominant rodents captured, accounting for 99.50% of all small mammals caught in the HAPA.

In the LAAA areas of the Yili River valley region, A. sylvaticus and M. musculus were dominant, accounting for 39.06% (232/594) and 49.49% (249/594) of the rodent species present, respectively. However, no M. musculus or R. norvegicus (brown rats) were found infected with E. multilocularis metacestodes, and only one A. sylvaticus was shown infected. Accordingly, although M. musculus, brown rats and A. sylvaticus were dominant rodent species in the LAAA, M. erythrourus and R. opimus may play major roles in the transmission of E. multilocularis in this area.

The prevalence of E. multilocularis in Microtus spp was 15.01%. All these voles were captured from the HAPA between 1980 and 2500 meters above sea level. Geographically, altitude and rainfall impact the landscape and habitats, with grasslands favorable to Microtus spp voles. This may in turn impact the transmission of AE [2835]. In Yili Prefecture, four counties in the higher altitude areas had higher AI of human AE than those counties in lower altitude areas. In the high mountainous areas, Microtus spp voles were the dominant small mammals captured and these had a very high prevalence of E. multilocularis . The distribution of human AE seems to be associated with the distribution of abundant vole populations [3436]. We identified 0.40% of A. sylvaticus infected with E. multilocularis metacestodes. In addition, in the low altitude mountainous areas, 8.00% of R. opimus and 4.26% of M. erythrourus were infected, indicating that these two species may play a role in the transmission of AE although they are not the dominant species present [33,37].

Among the other small mammal species captured, four E. trancrei were recorded, with two infected. This species is more subterranean than Microtus spp. and is widespread on the grasslands of Central Asia [32]. Its role in E. multilocularis transmission needs clarification as it depends on the still unknown capacity of dogs and fox to prey on this species [38,39].

E. multilocularis is common on the Qinghai-Tibetan Plateau [7,8,40,41] and in Central Asia [20,42]. Geographically these two endemic areas are separated by the Kunlun and Tianshan Mountains and the Taklamakan Desert. In this study, we determined that DNA sequences of E. multilocularis isolates from Yili were genetically similar to isolates from Central Asia and Europe [4346].

Here, small mammals were captured using a “drowning method” leading to their sampling close to nearby water points. In the summer season, herdsmen are highly dispersed in the mountain pastures and live in tents generally situated 10–50 meters away from streams or creaks. Our field survey showed that in these areas the density of voles was high, resulting in an increased risk of infection in dogs accompanying the herdsman due to their being in close proximity to higher densities of E. multilocularis intermediate hosts. In general, the sustainability of transmission of E. multilocularis depends on a wildlife, predator/prey, cycle mainly involving foxes/dogs and 40 species of small mammals with transmission impacted by landscape changes [33,34,37]. We found that there were only two species of small mammals from the HAPA, and seven species from the LAAA. The results indicate that the prevalence of AE was higher in areas of relatively low small mammal biodiversity than in more diverse host communities. In low diversity small mammal communities, potential intermediate host species are prone to population outbreaks. Also, grass productivity and forest cover are associated with rainfall and temperature, and these features are correlated (locally) with altitude [32]. Consequently, this resulted in an increased risk of infection in herdsman. Dosing dogs at least once a month with baited praziquantel may prevent the transmission of E. multilocularis to this herdsmen community [47].

Conclusion

In summary, Yili Prefecture, Xinjiang is highly endemic for AE where voles (Microtus spp.) likely play a crucial role in its transmission. The high AE incidence in the Kazak and Mongolian communities is probably due to farmers raising sheep in the summer season in high-altitude pasture areas where there are significant numbers of small mammals infected with E. multilocularis; this enhances AE transmission due to close contact of these farmers with their sheep dogs.

Acknowledgements

We are grateful to the Centers for Disease Control and Prevention for their assistance in the capture and autopsy of rodents in Xinyuan, Nileke and Zhaosu. We also thank Mr. Ma Jianjun for providing information about the rodent sampling locations.

References

McManusDP, GrayDJ, ZhangW, YangY. Diagnosis, treatment, and management of echinococcosis. BMJ. 2012;344:e3866 doi: 10.1136/bmj.e3866

WenH, VuittonL, TuxunT, LiJ, VuittonDA, ZhangW, et al Echinococcosis: Advances in the 21st Century. Clin Microbiol Rev. 2019;32(2). doi: 10.1128/CMR.00075-18

TorgersonPR, KellerK, MagnottaM, RaglandN. The global burden of alveolar echinococcosis. PLoS Negl Trop Dis. 2010;4(6):e722 doi: 10.1371/journal.pntd.0000722

DeplazesP, RinaldiL, Alvarez RojasCA, TorgersonPR, HarandiMF, RomigT, et al Global Distribution of Alveolar and Cystic Echinococcosis. Adv Parasitol. 2017;95:315493. doi: 10.1016/bs.apar.2016.11.001

ThompsonRC. Biology and Systematics of Echinococcus. Adv Parasitol. 2017;95:65109. doi: 10.1016/bs.apar.2016.07.001

HanXM, CaiQG, WangW, WangH, ZhangQ, WangYS. Childhood suffering: hyper endemic echinococcosis in Qinghai-Tibetan primary school students, China. Infect Dis Poverty. 2018;7(1):71 doi: 10.1186/s40249-018-0455-y

FengX, QiX, YangL, DuanX, FangB, GongsangQ, et al Human cystic and alveolar echinococcosis in the Tibet Autonomous Region (TAR), China. J Helminthol. 2015;89(6):671679. doi: 10.1017/S0022149X15000656

LiT, ChenX, ZhenR, QiuJ, QiuD, XiaoN, et al Widespread co-endemicity of human cystic and alveolar echinococcosis on the eastern Tibetan Plateau, northwest Sichuan/southeast Qinghai, China. Acta Trop. 2010;113(3):248256. doi: 10.1016/j.actatropica.2009.11.006

TorgersonPR. The emergence of echinococcosis in central Asia. Parasitology. 2013;140(13):16671673. doi: 10.1017/S0031182013000516

10 

ZhouHX, ChaiSX, CraigPS, DelattreP, QuereJP, RaoulF, et al Epidemiology of alveolar echinococcosis in Xinjiang Uygur autonomous region, China: a preliminary analysis. Ann Trop Med Parasitol. 2000;94(7):715729. doi: 10.1080/00034983.2000.11813595

11 

Yili Kazak Autonomous Prefecture Bureau of Statistics. Statistical Bulletin of National Economic and Social Development of Yili Kazakh Autonomous Prefecture in 2015. Mar. 2016. https://wenku.baidu.com/view/13322d54fd0a79563d1e72e4.html

12 

Bresson-HadniS, VuittonDA, BartholomotB, HeydB, GodartD, MeyerJP, et al A twenty-year history of alveolar echinococcosis: analysis of a series of 117 patients from eastern France. Eur J Gastroenterol Hepatol. 2000;12(3):327336. doi: 10.1097/00042737-200012030-00011

13 

VaniscotteA, PleydellD, RaoulF, QuereJP, JiaminQ, WangQ, et al Modelling and spatial discrimination of small mammal assemblages: an example from Western Sichuan (China). Ecol Modell. 2009;220(9–10):12181231. doi: 10.1016/j.ecolmodel.2009.02.019

14 

WuC, ZhangW, RanB, FanH, WangH, GuoB, et al Genetic variation of mitochondrial genes among Echinococcus multilocularis isolates collected in Western China. Parasit Vectors. 2017;10(1):265 doi: 10.1186/s13071-017-2172-y

15 

GuoG, ShengJ, WuX, WangY, GuoL, ZhangX, et al Seoul virus in the Brown Rat (Rattus norvegicus) from Urumqi, Xinjiang, Northwest of China. J Wildl Dis. 2016;52(3):705708. doi: 10.7589/2015-08-210

16 

SchweigerA, GrimmF, TannerI, MullhauptB, BertoggK, MullerN, et al Serological diagnosis of echinococcosis: the diagnostic potential of native antigens. Infection. 2012;40(2):139152. doi: 10.1007/s15010-011-0205-6

17 

NakaoM, XiaoN, OkamotoM, YanagidaT, SakoY, ItoA. Geographic pattern of genetic variation in the fox tapeworm Echinococcus multilocularis. Parasitol Int. 2009;58(4):384389. doi: 10.1016/j.parint.2009.07.010

18 

JingyeS, GuangjiaZ, WenjieY, WeiH, QianW, BoZ, et al Molecular characterization of human echinococcosis in Sichuan, Western China. Acta Trop. 2019;190:4551. doi: 10.1016/j.actatropica.2018.09.019

19 

YuSH, WangH, WuXH, MaX, LiuPY, LiuYF, et al Cystic and alveolar echinococcosis: an epidemiological survey in a Tibetan population in southeast Qinghai, China. Jpn J Infect Dis. 2008;61(3):242246.

20 

ZhangW, ZhangZ, WuW, ShiB, LiJ, ZhouX, et al Epidemiology and control of echinococcosis in central Asia, with particular reference to the People's Republic of China. Acta Trop. 2015;141(Pt B):235243. doi: 10.1016/j.actatropica.2014.03.014

21 

AfonsoE, KnappJ, TeteN, UmhangG, RieffelD, van KesterenF, et al Echinococcus multilocularis in Kyrgyzstan: similarity in the Asian EmsB genotypic profiles from village populations of Eastern mole voles (Ellobius tancrei) and dogs in the Alay valley. J Helminthol. 2015;89(6):664670. doi: 10.1017/S0022149X15000474

22 

GottsteinB, WangJ, BoubakerG, MarinovaI, SpiliotisM, MullerN, et al Susceptibility versus resistance in alveolar echinococcosis (larval infection with Echinococcus multilocularis). Vet Parasitol. 2015;213(3–4):103109. doi: 10.1016/j.vetpar.2015.07.029

23 

VuittonDA, AziziA, RichouC, VuittonL, BlagosklonovO, DelabrousseE, et al Current interventional strategy for the treatment of hepatic alveolar echinococcosis. Expert Rev Anti Infect Ther. 2016;14(12):11791794. doi: 10.1080/14787210.2016.1240030

24 

JunghanssT, da SilvaAM, HortonJ, ChiodiniPL, BrunettiE. Clinical management of cystic echinococcosis: state of the art, problems, and perspectives. Am J Trop Med Hyg. 2008;79(3):301311.

25 

NazligulY, KucukazmanM, AkbulutS. Role of chemotherapeutic agents in the management of cystic echinococcosis. Int Surg. 2015;100(1):112114. doi: 10.9738/INTSURG-D-14-00068.1

26 

LiT, ItoA, PengcuoR, SakoY, ChenX, QiuD, et al Post-treatment follow-up study of abdominal cystic echinococcosis in Tibetan communities of Northwest Sichuan Province, China. PLoS Negl Trop Dis. 2011;5(10):e1364 doi: 10.1371/journal.pntd.0001364

27 

BrunettiE, KernP, VuittonDA, Writing Panel for the W-I. Expert consensus for the diagnosis and treatment of cystic and alveolar echinococcosis in humans. Acta Trop. 2010;114(1):116. doi: 10.1016/j.actatropica.2009.11.001

28 

LiuCN, XuYY, Cadavid-RestrepoAM, LouZZ, YanHB, LiL, et al Estimating the prevalence of Echinococcus in domestic dogs in highly endemic for echinococcosis. Infect Dis Poverty. 2018;7(1):77 doi: 10.1186/s40249-018-0458-8

29 

Cadavid RestrepoAM, YangYR, McManusDP, GrayDJ, BarnesTS, WilliamsGM, et al Environmental risk factors and changing spatial patterns of human seropositivity for Echinococcus spp. in Xiji County, Ningxia Hui Autonomous Region, China. Parasit Vectors. 2018;11(1):159 doi: 10.1186/s13071-018-2764-1

30 

Cadavid RestrepoAM, YangYR, McManusDP, GrayDJ, GiraudouxP, BarnesTS, et al The landscape epidemiology of echinococcoses. Infect Dis Poverty. 2016;5(1). doi: 10.1186/s40249-016-0109-x

31 

PiarrouxM, GaudartJ, Bresson-HadniS, BardonnetK, FaucherB, GrenouilletF, et al Landscape and climatic characteristics associated with human alveolar echinococcosis in France, 1982 to 2007. Euro Surveill. 2015;20(18). doi: 10.2807/1560-7917.es2015.20.18.21118

32 

GiraudouxP, RaoulF, AfonsoE, ZiadinovI, YangY, LiL, et al Transmission ecosystems of Echinococcus multilocularis in China and Central Asia. Parasitology. 2013;140(13):16551666. doi: 10.1017/S0031182013000644

33 

GiraudouxP, RaoulF, PleydellD, LiT, HanX, QiuJ, et al Drivers of Echinococcus multilocularis transmission in China: small mammal diversity, landscape or climate? PLoS Negl Trop Dis. 2013;7(3):e2045 doi: 10.1371/journal.pntd.0002045

34 

GiraudouxP, CraigPS, DelattreP, BaoG, BartholomotB, HarragaS, et al Interactions between landscape changes and host communities can regulate Echinococcus multilocularis transmission. Parasitology. 2003;127(7):S119S29.

35 

VielJF, GiraudouxP, AbrialV, Bresson-HadniS. Water vole (Arvicola terrestris scherman) density as risk factor for human alveolar echinococcosis. Am J Trop Med Hyg. 1999;61(4):559565. doi: 10.4269/ajtmh.1999.61.559

36 

GiraudouxP, PleydellD, RaoulF, QuereJP, WangQ, YangY, et al Transmission ecology of Echinococcus multilocularis: what are the ranges of parasite stability among various host communities in China? Parasitol Int. 2006;55 Suppl:S237S246. doi: 10.1016/j.parint.2005.11.036

37 

PleydellDR, YangYR, DansonFM, RaoulF, CraigPS, McManusDP, et al Landscape composition and spatial prediction of alveolar echinococcosis in southern Ningxia, China. PLoS Negl Trop Dis. 2008;2(9):e287 doi: 10.1371/journal.pntd.0000287

38 

WangX, LiuJ, ZuoQ, MuZ, WengX, SunX, et al Echinococcus multilocularis and Echinococcus shiquicus in a small mammal community on the eastern Tibetan Plateau: host species composition, molecular prevalence, and epidemiological implications. Parasit Vectors. 2018;11(1):302 doi: 10.1186/s13071-018-2873-x

39 

RaoulF, DeplazesP, RieffelD, LambertJC, GiraudouxP. Predator dietary response to prey density variation and consequences for cestode transmission. Oecologia. 2010;164(1):129139. doi: 10.1007/s00442-010-1647-8

40 

WangQ, QiuJ, YangW, SchantzPM, RaoulF, CraigPS, et al Socioeconomic and behavior risk factors of human alveolar echinococcosis in Tibetan communities in Sichuan, People's Republic of China. Am J Trop Med Hyg. 2006;74(5):856862.

41 

Li TYQJ, YangW, CraigPS, ChenXW, XiaoN, et al Echinococcosis in Tibetan populations, western Sichuan Province, China. Emerg Infect Dis. 2005;11(12):18661873. doi: 10.3201/eid1112.050079

42 

AbdybekovaA, SultanovA, KaratayevB, ZhumabayevaA, ShapiyevaZ, YeshmuratovT, et al Epidemiology of echinococcosis in Kazakhstan: an update. J Helminthol. 2015;89(6):647650. doi: 10.1017/S0022149X15000425

43 

BeiromvandM, AkhlaghiL., Fattahi MassomS.H., MeamarA.R., DarvishJ., RazmjouE. Molecular identification of Echinococcus multilocularis infection in small mammals from northeast, Iran. PLoS Negl Trop Dis. 2013;7(7): e2313 doi: 10.1371/journal.pntd.0002313

44 

KonyaevSV, YanagidaT, IngovatovaGM, ShoikhetYN, NakaoM, SakoY, et al Molecular identification of human echinococcosis in the Altai region of Russia. Parasitol Int. 2012;61(4):711714. doi: 10.1016/j.parint.2012.05.009

45 

BeiromvandM, AkhlaghiL., Fattahi MassomS.H., MobediI., MeamarA.R.,OormazdiH., MotevalianA., RazmjouE. Detection of Echinococcus multilocularis in carnivores in Razavi Khorasan province, Iran using mitochondrial DNA. PLoS Negl Trop Dis. 2011;5(11):e1379 doi: 10.1371/journal.pntd.0001379

46 

GesyKM, SchurerJM, MassoloA, LiccioliS, ElkinBT, AlisauskasR, et al Unexpected diversity of the cestode Echinococcus multilocularis in wildlife in Canada. Int J Parasitol Parasites Wildl. 2014;3(2):8187. doi: 10.1016/j.ijppaw.2014.03.002

47 

ZhangW, ZhangZ, YimitT, ShiB, AiliH, TulsonG, et al A pilot study for control of hyperendemic cystic hydatid disease in China. PLoS Negl Trop Dis. 2009;3(10):e534 doi: 10.1371/journal.pntd.0000534

29 Mar 2020

Dear Dr. Zhang,

Thank you very much for submitting your manuscript "High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang, China is associated with pasture landscape and the distribution of Microtus spp. and animal farming activity" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

There are some substantial issues, particularly those identified by the second reviewer. The manuscript can be reconsidered only if all these issues are adequately addressed.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Paul Robert Torgerson

Guest Editor

PLOS Neglected Tropical Diseases

Mar Siles-Lucas

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

There are some substantial issues, particularly those identified by the second reviewer. The manuscript can be reconsidered only if all these issues are adequately addressed.

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Please see below.

Reviewer #2: Information needs to be provided on when (year/season) small mammal trapping occurred.

The human aspect of the paper largely follows the methods of Zhou et al. (2000). That being said, additional information is needed in the Methods on who these AE patients represent (there is some additional information provided in the Discussion). The cases appear to be those with severe clinical disease seen in facilities with surgical capabilities. Are these the only hospitals/clinics in the region that treat AE patients? Due to the chronic nature of AE and the presumed lack of medical access for some cases, a clear description of the study population needs to be supplied so that the reader can understand the measure(s) of frequency used.

Even though case numbers are small, displaying the values as cumulative prevalence results in lost information. The authors are also not consistent with their frequency of infection terminology (e.g., switching between prevalence and incidence).

Realizing the difficulty in reconnecting with patients in this location, patient follow-up information is largely incomplete. Any form of follow-up contact could only be made with 7.3% of patients (n=21) so it is difficult to draw any conclusions from this information. In addition, no information is provided about these patients’ year of treatment, age, sex, or comorbidities.

Data analysis methods are very simple and don’t make any attempt to evaluate associations between human AE cases and small mammal distribution, landscape, or farming activity as indicated by the paper’s title.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Please see below.

Reviewer #2: Much of the results can be summarized in tables rather than presented in the text.

The abstract states that "...E. multilocularis DNA sequences from small mammals were identical to isolates from local AE cases." However, I don't see where sequence data from local human cases were obtained or discussed as part of this study. Please clarify.

Please confirm the geographic origins of sequences KT965441 and KT965439. They differ between the text and figure 4.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Please see below.

Reviewer #2: There is quite a bit of repetition of Results in the Discussion.

It would be helpful if the flow of the Discussion mirrored the Methods and Results rather than moving from human AE frequency, to small mammal distribution, back to clinical management of AE cases.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: The authors refer to the use of experimental animals (line 100). Please clarify if this is simply another reference to the trapped small mammals or if there was a separate group of animal subjects.

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang, China is associated with pasture landscape and the distribution of Microtus spp. and animal farming activity

The study demonstrated the status of Alveolar Echinococcosis in Yili prefecture in Xinjiang region of China based on historic hospital and field data in the last two decades. The area is one of the most endemic regions of AE in the world and the information provided in the study are required for implementation of any control program. Several issues need to be addressed before the manuscript be considered for publication:

Major points

___________________

- Line 132 & 200: "To calculate the prevalence of AE" and "to estimate the annual prevalence over the two decades". As the authors investigated the occurrence of new AE cases during a period of time, it is more accurate to use "Incidence".

- Line 168-176: No need to provide much details on DNA extraction method, "according to the manufacturer’s instructions" is fine.

- No data have been provided for sex distribution of the patients. Please tabulate data on the age- and sex-specific incidence of AE in different ethnicities/regions.

- Please provide the Mean and Median age of the patients.

- Patient survival data are very valuable. It would be great to tabulate survival data and provide 5-year survival rates (absolute or relative) of AE patients (the percentage of AE patients living five years after the disease is diagnosed).

Also please report the Median survival that is the period of time after which 50% of the patients have died and 50% have survived.

- Were there any patients undergoing liver transplantation? If yes please provide details of the prognosis and patients conditions.

- The method used for detecting protoscoleces in the cysts is not clear.

- Line 262: "We also captured 16 from HAPA in Chabuchaer County", this county has already been categorized in LAAA region! Please clarify.

- Please provide chi-square analysis results for comparing differences among time periods and ethnic groups.

- Contradictory statements written in line 280-283 on Rhombomys and Meriones infection !

- In Fig. 1 no sampling site (cross) has been specified for the farming areas. Does it mean all the samples were taken from the pasture areas?

- According to the Fig. 2, several AE cases were observed in adolescents under 15 years of age. this is an interesting finding. Please provide additional data on these AE patients. The nature of AE in children and adolescents is unknown therefore these type of information are very valuable.

- It is not clear which haplotype from where? has the highest frequency. To understand the extent of genetic variation within E. multilocularis isolates from Xinjiang please provide (in a table) more data on the frequency distribution of 16 haplotypes according to different locations and other variables if applicable.

- Line 204: The study found that 73.08% of AE patients had been diagnosed in the last 10 years, please specify that if this is because of more diagnostic facilities provided in recent years or more active case-finding or more intense disease transmission or more patients seeking treatment etc.? please elaborate more on this.

- line 382: "Microtus suppress the production of PSCs." As the method used for PSC detection is not clear, this statement is not justifiable. Several studies across the continents have shown that different Microtus spp. are highly potent intermediate hosts for E. multilocularis, i.e they are favorite preys for the definitive hosts, susceptible to E. multilocularis with a high population density (see Ecology and Life Cycle Patterns of Echinococcus Species, Adv. Parasitol. 2017; and Giraudoux et al. 2013). Therefore as no evidence has been presented in the study, it is quite premature to say "Microtus spp. suppress protoscoleces production". In addition the authors demonstrate further contradictions in the Title (line 1-3) and Conclusion section (line 414-415) when they talked about the crucial role of Microtus in AE transmission in the region ! Please elaborate more on this.

- Please provide separate descriptions for the two phylogenetic trees in the legend for Fig. 4.

Minor points

__________________

- line 177: PCR or nested-PCR ?

- Line 206: "Kazak (53.50% (153/286))" is redundant.

- line 280: "2 of 25 Rhombomys opimus," is redundant.

- Line 297: the GenBank accession number KT965411 is for Influenza A virus !

- Please be consistent with reporting decimals, choose either one or two decimal places all over the manuscript.

- line 365: Em > E. multilocularis

Thank you.

Reviewer #2: The title does not appear to align with the study’s contents. No formal spatial or statistical evaluation was conducted between human AE cases and small mammal distribution, landscape, or farming activity.

The study is comprised of two parts. The first describes AE cases from Yili Prefecture seen at four regional hospitals from 1989-2015.The second part describes the proportion of trapped small mammals from four counties in the same prefecture that were positive for AE. Parasite sequence analysis was subsequently performed on samples obtained from these small mammal intermediate hosts. There are no true study objectives provided and, unlike the title would suggest, only basic statistical comparisons were performed.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr. Majid Fasihi Harandi

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see https://journals.plos.org/plosntds/s/submission-guidelines#loc-methods


26 May 2020

Submitted filename: Response.doc

15 Jun 2020

Dear Dr. Zhang,

Thank you very much for submitting your manuscript "High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang, China: the prevalence of the disease in different ethnic communities and small mammals" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Paul Robert Torgerson

Guest Editor

PLOS Neglected Tropical Diseases

Mar Siles-Lucas

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Please see "Summary and General Comments".

Reviewer #2: See summary and general comments.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Please see "Summary and General Comments".

Reviewer #2: See summary and general comments.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Please see "Summary and General Comments".

Reviewer #2: See summary and general comments.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Please see "Summary and General Comments".

Reviewer #2: See summary and general comments.

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: Following most of the reviewers comments, the manuscript is remarkably improved. However several comments have not been addressed in the revised version:

- Ref to the Reviewer #2 comment, in Discussion, the "Treatment and follow-up" section has come after small mammal section, please follow the reviewer comment and put all clinical human data together.

- Line 168: "RNA free-water" is not correct.

- "there is no need to do chi-square test" So please modify the Statistical analysis section in M&M (Ref to the Reviewer #1 comment).

- Ref to the Reviewer #1 comment, please note that Em, Eg, Ro, As, Et are taxonomically / biologically non-sense. Please use standard scientific nomenclature.

- English writing needs a revision.

- line 442: was preformed > was performed

Reviewer #2: The manuscript is somewhat improved. However, numerous grammatical errors still exist. In addition, the authors make several statements regarding relationships between human AE cases and perceived risk factors that are not directly supported by study data. Please find my specific comments below (line numbers refer to the Word document with track changes).

Based on the study design, I would suggest that the authors moderate the statement, “The overall results indicate that the transmission of AE is highly associated with landscape and distribution of M. obscurus in Yili Prefecture” since they didn’t evaluate landscape or statistical associations between small mammal distribution and human AE cases. (lines 50-52) [Wording in the author summary is slightly better.]

I’m also not sure how the authors came to the conclusion that “…sheep-farming activity is a risk for infection”. (line 43)

Information in Table 6 (E. multilocularis haplotypes and accession numbers) needs to be elaborated upon. It is not clear if these samples were from small mammals or humans (or if these are samples from the current study or a previous study). The authors also need to provide support for the statement, “…E. multilocularis DNA sequences from small mammals were identical to isolates from local human AE cases”. (lines 49-50)

The statement in lines 93-96 (“In this study, we retrospectively collected human AE cases from eight counties and one city in Yili Prefecture, which shows that AE prevalence was increasing in the 20 years period, especially in the last decade and the prevalence of AE is likely associated with landscape features.”) doesn’t belong in the introduction. Again, this study did not evaluate landscape features.

The authors state that, “The Chi-Square test was used to compare the differences in prevalence between time periods, counties, and ethnic groups.” However, I don’t see where chi-square values (and associated p-values) for time periods are presented in the Results section. In addition, chi-square findings for ethnic groups and counties are not clearly presented (please also see my comment regarding the figure 2 legend). (lines 199-200)

Are the provided ages for the follow-up patients, their ages at the time of follow-up or at diagnosis? What about those who had died during the follow-up period? In general, the “follow-up of AE patients” section is very difficult to follow and would benefit from restructuring and clarification when presenting information about time since diagnosis and time since surgery for both patients who are still alive and for those who have died.

Please clarify what is meant by “21 samples working”. (line 343)

Figure 2 legend- What do the authors mean by “an asterisk indicates above average”?

Figure 3 doesn’t appear to be referenced in the text.

The authors added the following section to the revised document: “An ultrasound survey about 4000 residents per county on echinococcosis was preformed in 2013(data not shown). In this year, a total of 33 AE cases were registered, which is 11.40 more than the average (21.60) of AE cases from 2012 to 2016 (with AE cases being 20, 33, 20, 18 and 17 respectively), indicating that the mass screen had a limit impact on the growth of AE cases in the last 10 years.” This statement is confusing and I don’t think it addresses the question regarding possible changes to patient access to care over the study time period.

Overall, the flow of the Discussion remains disjointed.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Majid Fasihi Harandi

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see https://journals.plos.org/plosntds/s/submission-guidelines#loc-methods


1 Aug 2020

Submitted filename: Response.docx

31 Aug 2020

Dear Dr. Zhang,

Thank you very much for submitting your manuscript "High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang Autonomous Region, the People’s Republic of China: the prevalence of the disease in different ethnic communities and in small mammals" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

The reviewers have found the revision largely satisfactory. However, before final acceptance of this manuscript, the authors need to ensure that reporting of population data with regard to diseases is standardized and using the correct epidemiological terms. For human cases is incidence per 100,000 per year. Please ensure all human incidence data is reported as such. From the materials and methods it seems the “cumulative prevalence” was based on the period 1989-2015, thus over a period of 27 years. This is confusing when making comparisons to other studies and gives a false impression that the incidence is somewhat higher than it is in reality.

In the author summary the way prevalence is reported is just wrong. Prevalence is the proportion with the disease at one point in time...ie if an ultrasound study found 31 cases in as survey of 100,000 the prevalence is 31/100,000 = 0.000031 or 0.0031%. If they are reporting incidence it should be the (average) annual incidence, which if it is 31.62 cases/100,000 in 27 years (as implied by the text) then the mean annual incidence is 1.17 cases per 100,000. Since the cases were based on hospital records of patients (as described in materials and methods) presenting for treatment, then the data is almost certainly incidence data and hence should be reported as an annual incidence of 0.49-1.17 cases / 100,000, Thus the annual incidence of 0.49-1.17 cases/100,000 in the high altitude mountainous areas was higher than the annual incidence of 0.180-0.282 cases per 100,000 seen in the low level areas. Likewise Mongolian (annual incidence 1.987/100,000) and Kazakh (annual incidence 0.897/100,000) had a higher incidence…...

It is extremely important to use standard epidemiological terms so that studies can be easily compared and trends in data seen. The standardized means of reporting numbers of human cases of any disease is annual incidence per 100,000 population.

In the results section they have reported “annual prevalence” in some cases. This is not prevalence data, it is annual incidence, again correct the terminology. Likewise it is trend in incidence NOT prevalence. They have no prevalence data in humans in this study. They have correctly reported prevalence data in small mammals (ie proportion of small mammals infected).

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.  

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript. 

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Paul Robert Torgerson

Associate Editor

PLOS Neglected Tropical Diseases

Mar Siles-Lucas

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

The reviewers have found the revision largely satisfactory. However, before final acceptance of this manuscript, the authors need to ensure that reporting of population data with regard to diseases is standardized and using the correct epidemiological terms. For human cases is incidence per 100,000 per year. Please ensure all human incidence data is reported as such. From the materials and methods it seems the “cumulative prevalence” was based on the period 1989-2015, thus over a period of 27 years. This is confusing when making comparisons to other studies and gives a false impression that the incidence is somewhat higher than it is in reality.

In the author summary the way prevalence is reported is just wrong. Prevalence is the proportion with the disease at one point in time...ie if an ultrasound study found 31 cases in as survey of 100,000 the prevalence is 31/100,000 = 0.000031 or 0.0031%. If they are reporting incidence it should be the (average) annual incidence, which if it is 31.62 cases/100,000 in 27 years (as implied by the text) then the mean annual incidence is 1.17 cases per 100,000. Since the cases were based on hospital records of patients (as described in materials and methods) presenting for treatment, then the data is almost certainly incidence data and hence should be reported as an annual incidence of 0.49-1.17 cases / 100,000, Thus the annual incidence of 0.49-1.17 cases/100,000 in the high altitude mountainous areas was higher than the annual incidence of 0.180-0.282 cases per 100,000 seen in the low level areas. Likewise Mongolian (annual incidence 1.987/100,000) and Kazakh (annual incidence 0.897/100,000) had a higher incidence…...

It is extremely important to use standard epidemiological terms so that studies can be easily compared and trends in data seen. The standardized means of reporting numbers of human cases of any disease is annual incidence per 100,000 population.

In the results section they have reported “annual prevalence” in some cases. This is not prevalence data, it is annual incidence, again correct the terminology. Likewise it is trend in incidence NOT prevalence. They have no prevalence data in humans in this study. They have correctly reported prevalence data in small mammals (ie proportion of small mammals infected).

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: (No Response)

Reviewer #2: Please clarify if human data were collected from 1989-2015 or 1989-2016. The end date varies throughout the abstract and text.

Table 5- change infection rate to infection prevalence.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plosntds/s/submission-guidelines#loc-materials-and-methods


30 Sep 2020

Submitted filename: Dear Editor-response.doc

5 Oct 2020

Dear Dr. Zhang,

Thank you very much for submitting your manuscript "High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang Autonomous Region, the People’s Republic of China: the infection situation of the disease in different ethnic communities and in small mammals" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

The authors were requested to report the incidence of reported cases in the standard format of cases per 100,000 per year. This they have failed to do, indeed there seems to be little effort to address this concern. As previously stated, this is very important top avoid confusion and misrepresentation of the epidemiology of this disease. Citing a cumulative incidence for example of 53.67/100,000 for example, will be interpreted as 53.67/100,000 per year (if the small print is not read or understood). There has been a modest attempt in the results section to include the data as annual incidence per 100,000, but this has not been included in the abstract and summary. Assuming this represents the number of cases over the26 years of the study period, then the mean annual incidence is 2.1 cases per 100,000 per year, which is typical of incidence in highly endemic regions. Also, since there were only 286 cases reported in this period from the relevant counties in Yili prefecture over 26 years. This is not a problem, but then converting it to cumulative incidence in the manner the authors have, give a false impression as to the extent of the disease. This manuscript should not be published until they have standardized the incidence data as cases per 100,000 per year throughout the manuscript and removed the emphasis on cumulative incidence.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Paul Robert Torgerson

Associate Editor

PLOS Neglected Tropical Diseases

Mar Siles-Lucas

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

The authors were requested to report the incidence of reported cases in the standard format of cases per 100,000 per year. This they have failed to do, indeed there seems to be little effort to address this concern. As previously stated, this is very important top avoid confusion and misrepresentation of the epidemiology of this disease. Citing a cumulative incidence for example of 53.67/100,000 for example, will be interpreted as 53.67/100,000 per year (if the small print is not read or understood). There has been a modest attempt in the results section to include the data as annual incidence per 100,000, but this has not been included in the abstract and summary. Assuming this represents the number of cases over the26 years of the study period, then the mean annual incidence is 2.1 cases per 100,000 per year, which is typical of incidence in highly endemic regions. Also, since there were only 286 cases reported in this period from the relevant counties in Yili prefecture over 26 years. This is not a problem, but then converting it to cumulative incidence in the manner the authors have, give a false impression as to the extent of the disease. This manuscript should not be published until they have standardized the incidence data as cases per 100,000 per year throughout the manuscript and removed the emphasis on cumulative incidence.

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see https://journals.plos.org/plosntds/s/submission-guidelines#loc-methods


13 Oct 2020

Submitted filename: Response.docx

15 Oct 2020

Dear Dr. Zhang,

We are pleased to inform you that your manuscript 'High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang Autonomous Region, the People’s Republic of China: infection status in different ethnic communities and in small mammals' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Paul Robert Torgerson

Associate Editor

PLOS Neglected Tropical Diseases

Mar Siles-Lucas

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************


13 Jan 2021

Dear Dr. Zhang,

We are delighted to inform you that your manuscript, " High endemicity of alveolar echinococcosis in Yili Prefecture, Xingjiang Autonomous Region, the People’s Republic of China: infection status in different ethnic communities and in small mammals," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

https://www.researchpad.co/tools/openurl?pubtype=article&doi=10.1371/journal.pntd.0008891&title=High endemicity of alveolar echinococcosis in Yili Prefecture, Xinjiang Autonomous Region, the People’s Republic of China: Infection status in different ethnic communities and in small mammals&author=&keyword=&subject=Research Article,Medicine and Health Sciences,Medical Conditions,Parasitic Diseases,Helminth Infections,Echinococcosis,Medicine and Health Sciences,Medical Conditions,Tropical Diseases,Neglected Tropical Diseases,Echinococcosis,Biology and Life Sciences,Organisms,Eukaryota,Animals,Vertebrates,Amniotes,Mammals,Biology and Life Sciences,Zoology,Animals,Vertebrates,Amniotes,Mammals,Medicine and Health Sciences,Surgical and Invasive Medical Procedures,Biology and Life Sciences,Organisms,Eukaryota,Animals,Vertebrates,Amniotes,Mammals,Rodents,Voles,Biology and Life Sciences,Zoology,Animals,Vertebrates,Amniotes,Mammals,Rodents,Voles,Biology and Life Sciences,Organisms,Eukaryota,Animals,Vertebrates,Amniotes,Mammals,Dogs,Biology and Life Sciences,Zoology,Animals,Vertebrates,Amniotes,Mammals,Dogs,Medicine and Health Sciences,Epidemiology,Medicine and Health Sciences,Medical Conditions,Parasitic Diseases,Helminth Infections,Echinococcosis,Alveolar Echinococcosis,Medicine and Health Sciences,Medical Conditions,Tropical Diseases,Neglected Tropical Diseases,Echinococcosis,Alveolar Echinococcosis,Biology and Life Sciences,Genetics,Heredity,Genetic Mapping,Haplotypes,