Hepatitis C virus (HCV) is a 30–60 nm diameter, lipid-coated RNA virus and carries continuously a huge impact on liver-related events and hepatocellular carcinoma (HCC) globally [1]. According to the World Health Organization (WHO), there are 1.75 million new-infected cases annually, and still 75 million people have been suffering from chronic hepatitis C (CHC) worldwide. Approximately 399,000 people die directly due to CHC-related cirrhosis and HCC each year. The prevalence of anti-HCV seropositivity among adults in Taiwan was about 4.4%, much larger than other countries [2–4]. However, geographic difference of prevalence exists and it could reach to 15–20% in some hyperendemic areas in South Taiwan [5–7]. Therefore, research on HCV infection is of great significance to global health and public health.
Among all HCV genotypes, HCV genotype 1 (G-1) is the most prevalent in the world (46.2–49.1%), followed by G-3 (17.9–30.1%,), G-4 (8.3–16.8%), G-2 (9.1–11.0%), G-6 (5.4%), and G-5 (<1%) [8–10]. Apart from the implications of demographic epidemiology, different genotype may lead to different disease course and treatment outcomes. For example, G-1b leads to the highest incidence of developing cirrhosis and HCC [11–13]. The scenario becomes worse in heavy drinking, elders and HCV/ HIV co-infected [14–16]. G-3 infection is the next most prevalent genotype with 54.3 million patients globally. It is associated with an increasing risk of fibrosis, liver-related events, HCC, and overall mortality. G-3 infection may have a negative impact on histological and clinical outcomes in CHC patients. In addition, its characteristic features of steatosis and metabolic abnormalities may add more difficulty in the disease management [17–20]. Therefore, the precise determination of genotype in CHC patients is essential in a clinical setting. In addition, although G-1 and -2 were the major genotypes of HCV infection in Taiwan, geographic difference of genotype distribution occurs even in this beautiful country [21, 22].
In the past decade, direct-acting antivirals (DAAs), with the extremely high efficacy, low adverse effect, and short treatment duration, have become the main stream of HCV therapy. However, the successful treatment of HCV infection in some undeveloped and developing regions remains challenging because the cost and the affordability [23–25]. The precise diagnosis of genotyping is informative and critical for pretreatment assessment and subsequent therapeutic decision. To scale up HCV care cascade and HCV elimination, HCV genotyping may not be warranted at the population level. At the individual level, HCV genotyping might help to facilitate HCV treatment plan in terms of difficult-to-cure population (ex. HCV genotype 3) or to distinguish potential virological failure from reinfection. During the past decade, HCV genotyping technologies have been continuously improving, yielding many commercialized diagnostic assays for clinical purposes. Among them, Abbott RealTime HCV Genotype II Assay (HCV GT II, Abbott Laboratories, USA) is one of the widely-used assays for genotyping. However, clinical validation studies demonstrated that G-1a and G-1b subtypes could not be precisely identified among 6–7% G-1 (result showed type 1 only, no subtype-1a or 1b) samples, whereas 3–4% samples identified as indeterminate (detected HCV but did not produce a genotype result) genotype [26, 27].
In order to overcome the challenging issues, Abbott RealTime HCV Genotype Plus RUO assay (HCV GT Plus, Abbott Laboratories, USA), has been developed recently based on Taqman real-time PCR method [28–30]. The performance verification of HCV GT Plus in Taiwan still has no complete evaluation report so far. Consequently, we conducted the study aiming to elucidate the performance of the HCV GT Plus in the genotyping diagnosis. Its detection performance will be compared with the direct sequencing results.
This study was reviewed and approved by Institutional Review Board, Kaohsiung Medical University Hospital (KMUH/IRB/AF/2.8-01-11.0). The study was conducted in one medical centre and 2 regional hospitals in Southern Taiwan. We recruited those CHC patients with age and HCV viral loads criteria were over 20 years old above and over 500 IU/mL, respectively. All participants were informed of the research content and signed a written consent form. People with not detected for HCV RNA were suitable as negative control group. We also recruited the HCV genotype 1 with subtype 1a or 1b and genotype 6 previously genotyped by Abbott RealTime HCV GT II as positive control group. The patient’s serum samples were determinate for genotype from Oct 2017 through Aug 2018. All the eligible patients with genotype 1 without subtype and indeterminate previously genotyped by Abbott RealTime HCV GT II will further determinate by Abbott HCV RealTime HCV GT Plus. All of the genotype results were validated by 5' UTR sequencing as a reference standard. The patients with other viral infections such as HIV or HBV were excluded.
All the serum samples were centrifuged within 4 hours after the blood was drawn, and the HCV viral load, genotype was tested within 1 week by HCV GT II by using Abbott RealTime HCV m2000 PCR System. The qualified samples were stored in -70°C for further HCV GT Plus testing according to the manufacturer’s manual. Direct sequencing was done on 5’ UTR region by using ABI PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction Kit, v3.1 (Applied Biosystems) on the ABI PRISM 3730XL DNA Analyzer. Primers used for PCR amplification and sequencing of 5’ UTR region were TTGTGGTACTGCCTGATAGGG (forward) and GGATGTACCCCATGAGGTCG (reverse). The reverse transcription reaction was done by using High Capacity cDNA Reverse Transcription Kit according to the standard protocol of the supplier (Applied Biosystems) for 120 min at 37°C. The clinical data such as albumin, bilirubin, transaminase, gamma-glutamyl transferase (GGT), and lipids levels were measured on a multichannel auto analyzer (Hitachi Inc, Tokyo, Japan).
Data were expressed as mean ± interquartile range (IQR). Chi-square test, Wicoxon rank-sum test, Pearson correlation coefficient and simple linear regression were used when appropriate. Quality control procedures, database processing and analyses were performed using the SPSS 20 statistical package (SPSS Inc., Chicago, IL, USA).
A total of 100 viremic CHC patients were recruited, including 63 G-1 patients, and 37 patients of indeterminate genotyped by Abbott RealTime HCV GT II assay (HCV GT II), respectively. Five healthy volunteers who were not infected with HCV served as a negative control group (NCG, HCV RNA: Not detected); for the positive control group, HCV GT Plus confirmed HCV GT II characterized results for 100% (3/3) of 1a, with 100% (2/2), 100% (3/3) for 1b and type 6, respectively, validated by 5' UTR sequencing as a reference standard. Their demographical and clinical features of the patients are shown in Table 1.
For those 63 G-1 patients tested by HCV GT II, 59 (93.7%) patients were readily identified for their sub-genotypes or type by HCV GT Plus. There were 4 patients of G-1a, 29 patients of G-1b, 26 patients of G-6, and 4 patients of undetected, respectively. On the other side, for those 37 patients whose genotype showed indeterminate by HCV GT II, 23 (62.2%) patients could be genotyped by HCV GT Plus, including 3 patients of G-1b and 20 patients of G-6. We further used direct sequencing method based on 5' UTR sequence to test the performance of HCV GT Plus among those 63 G-1 patient samples detected by HCV GT II. The successful detection rate was 87.3% (55/63) by direct sequencing. The concordance rates between HCV GT Plus and direct sequencing method for G-1 samples was 84.8% (50/59), including 100% (4/4) of G-1a, 82.8% (24/29) of G-1b and 84.6% (22/26) of G-6.
Among those 26 patients who were genotyped G-1 by HCV GT II whereas G-6 genotype was identified on HCV GT Plus, 22 (84.6%) patients were of G-6 (G-6a = 7, 6e = 7, 6g = 4, 6u = 1, 6w = 3) by direct sequencing. Two of the 26 patients were genotyped as G-2 (Table 2).
| HCV GT II | HCV GT Plus | Direct sequencing | Concordance rate between HCV GT Plus and direct sequencing (%) | ||
|---|---|---|---|---|---|
| G-1 (n = 63) | Genotype | n | Genotype | n | |
| 1a | 4 | 1a | 4 | 100 | |
| 1b | 29 | 1b | 24 | 82.8 | |
| PCR failed | 5 | ||||
| 6 | 26 | 6† | 22 | 84.6 | |
| 2 | 2 | ||||
| PCR failed | 2 | ||||
| Not detected | 4 | 1b | 3 | - | |
| PCR failed | 1 | ||||
| NCP (n = 5) | Not detected | 5 | Not detected | 5 | 100 |
There were 37 indeterminate genotype patients tested by HCV GT II. Twenty-three (62.2%) samples could be genotyped by HCV GT Plus, including 3 of G-1b, and 20 of G-6, respectively. Among those 20 patients who were genotyped indeterminate by HCV GT II whereas G-6 genotype was identified on HCV GT Plus, 12 (60%) patients were of G-6 (G-6a = 3, 6c = 4, 6e = 3, 6g = 1, 6n = 1) by direct sequencing. Among those 14 samples not detected by HCV GT Plus, 10 of them were genotyped as G-2 infection by direct sequencing (Table 3).
| HCV GT II | HCV GT Plus | Direct sequencing | Concordance rate between HCV GT Plus and direct sequencing (%) | ||
|---|---|---|---|---|---|
| Indeterminate (n = 37) | Genotype | n | Genotype | n | |
| 1a | 0 | 1a | 0 | - | |
| 1b | 3 | 1b | 3 | 100 | |
| 6 | 20 | 6‡ | 12 | 60 | |
| PCR failed | 8 | ||||
| Not detected | 14 | 2 | 10 | - | |
| PCR failed | 4 | ||||
| NCP (n = 5) | Not detected | 5 | Not detected | 5 | 100 |
HCV strains are classified into eight recognized genotypes on the basis of phylogenetic and sequence analyses of whole viral genomes, further classified into 90 confirmed subtypes [31, 32]. HCV genotyping is essential in clinical setting for epidemiological study, implementation of therapeutic intervention, and outcome prediction [33–35]. Precise GT determination of genotypes by molecular diagnostic methods is a clinical challenging task with the current commercial assays, particularly in G-1 and indeterminate genotypes due to the high variability of HCV. The inability to distinguish G-6 subtypes might impact on redicted SVR to interferon (IFN)-based therapies in patients with apparent G-1 infection [35].
Taiwan government started to reimburse DAA with genotype specific regimens including daclatasvir /asunaprevir, paritaprevir/ritonavir/ombitasvir/dasabuvir, sofosbuvir/ledipasvir, sofosbuvir/ledipasvir and elbasvir/grazoprevir since 2017. For the pangenotypic DAAs, the National Health Insurance Administration of Taiwan start to reimburse glecaprevir/ pibrentasvir since Aug 2018 and sofosbuvir/velpatasvir since June 2019. Nowadays, available DAAs in Taiwan include elbasvir/grazoprevir, glecaprevir/ pibrentasvir and sofosbuvir/velpatasvir at the time of manuscript drafting. The choice of DAA regimens is at physicians’ discretion. Even though pangenotypic DAAs are available in Taiwan, it is mandatory to provide and upload HCV genotype data to the government while applying DAAs per request by the authority (https://www.nhi.gov.tw/Content_List.aspx?n=A4EFF6CD1C4891CA&topn=3FC7D09599D25979)
To our knowledge, this is the first study to address the characteristics of HCV GT Plus performance completely with G-1 and indeterminate patients in Taiwan. We demonstrated that the concordance rate was only 52.4% (33/63) between HCV GT II and HCV GT Plus in G-1 patients. G-6 and its variants, previously mistyped as G-1. HCV G-6, highly prevalent in the Asia–Pacific region, can be incorrectly classified as G-1 because they share similar nucleotide homology in the 5′UTR [36, 37]. Mainly infection areas of G-6 are concentrated in South Asia, including Vietnam, Thailand, Hong Kong and Macau [38, 39]. Ethnic groups are mainly prevalent in injection drug users (IDUs). The main infection subtype of G-6 in Taiwan was 6a [40], but this time we also found other G-6 subtypes (6c, 6e, 6g, 6n).
Direct sequencing confirmed HCV GT Plus results for 84.7% (50/59) of G-1, with 100% (4/4), 82.8% (24/29) and 84.6% (22/26) for 1a, 1b and GT 6, respectively. Therefore, the HCV GT Plus assay has a very good ability to distinguish 1a, 1b and G-6 in G-1 group.
Among the 37 patients of indeterminate genotype detected by HCV GT II, 62.2% (23/37) patients were readily identified for their sub-genotypes or type by HCV GT Plus. The concordance rate increased 65.2% (15/23) between HCV GT Plus and direct sequencing method. Our results thus provided the comparison between the 2 assays in clinical application. The discordant results between assays may also raise the concern of potential limitations for clinical precise diagnosis.
The Abbott Realtime HCV Plus RUO assay is an automated HCV genotyping method specifically targets the HCV core region with multiple TaqMan probes for HCV genotypes 1a, 1b, and 6. Addition of Core motifs could improve the discrimination between G-1 and G-6 [41].
Our results found that HCV GT Plus for G-1 group whether in the detection rate (93.7% vs. 62.2%, p = 0.10) or concordance (84.7% vs. 65.2%, p = 0.009) was better than indeterminate group.
The samples that have preliminary results from HCV GT II, the higher proportions genotype results will obtain by HCV Plus or direct sequencing.
For the indeterminate group, the detection rate was only 62.2%, 10 of 14 samples (37.8%) showed not detected due to 15 subtypes of type 2 [37] that HCV GT II cannot cover all subtypes and HCV GT Plus enhancements for 1a, 1b and type 6 only.
The HCV GT Plus could also potentially be used to resolve high rate (up to 34.9%) of misidentifying genotype 6 samples as genotype 1, confirmed by 5' UTR direct sequencing.
A variety of genotyping auxiliary methods (such as Okamoto typing or direct sequencing) have limitations in the past. Okamoto typing can only detect 1a, 1b, 2a, 2b and 3a, respectively [21]. Direct sequencing will also have some differences in the results due to the region selected by the primer’s position (5’untranslated region, core or Nonstructural protein 5B [42, 43].
Despite design limitations (core region for 1a, 1b, and 6 only, but 99% to be attributable to subtypes 1a and 1b and inability to detect all subtype of G-1 and G-6, the HCV Plus completes HCV GT II well and thus helps to overcome the shortcomings of the HCVGT II assay design, significantly reduced the frequency of G-1 without subtype results, while also providing the ability to identify G-6, reliably characterized confirmed by 5' UTR sequencing. Regardless of cost or time spent, HCV GT Plus assay is lower than direct sequencing. As far as auxiliary testing is concerned, HCV GT Plus assay is more convenient and cheaper than direct sequencing. Therefore, we recommend that Abbott RealTime HCV Genotype II Assay should be collocated with HCV GT Plus assay.
We are very grateful to Pey-Fang Wu and Yu-Fen Wang for giving suggestions to improve the manuscript.
21 Dec 2020
PONE-D-20-35973
The performance of HCV GT Plus RUO reagent in determining hepatitis C virus genotypes in Taiwan
PLOS ONE
Dear Dr. Huang,
Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process both in the methodology section and also editing of the manuscript.
Please submit your revised manuscript by Feb 01 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.
Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols
We look forward to receiving your revised manuscript.
Kind regards,
Isabelle Chemin, PhD
Academic Editor
PLOS ONE
Journal Requirements:
When submitting your revision, we need you to address these additional requirements.
1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at
https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and
2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.
If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.
3. Thank you for stating the following in the Acknowledgments Section of your manuscript:
"We gratefully thank the secretary help from Taiwan Liver Research Foundation
(TLRF) and the reagents provided by Abbott Molecular Diagnostics, Taiwan. They
did not influence how the study was conducted or the approval of the manuscript."
We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.
Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:
"The author(s) received no specific funding for this work."
Additionally, because some of your funding information pertains to commercial funding, we ask you to provide an updated Competing Interests statement, declaring all sources of commercial funding.
In your Competing Interests statement, please confirm that your commercial funding does not alter your adherence to PLOS ONE Editorial policies and criteria by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests. If this statement is not true and your adherence to PLOS policies on sharing data and materials is altered, please explain how.
Please include the updated Competing Interests Statement and Funding Statement in your cover letter. We will change the online submission form on your behalf.
Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests
4. Please amend the manuscript submission data (via Edit Submission) to include author Zu-Yau Lin.
5. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.
[Note: HTML markup is below. Please do not edit.]
Reviewers' comments:
Reviewer's Responses to Questions
Comments to the Author
1. Is the manuscript technically sound, and do the data support the conclusions?
The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.
Reviewer #1: Yes
**********
2. Has the statistical analysis been performed appropriately and rigorously?
Reviewer #1: N/A
**********
3. Have the authors made all data underlying the findings in their manuscript fully available?
The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.
Reviewer #1: Yes
**********
4. Is the manuscript presented in an intelligible fashion and written in standard English?
PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.
Reviewer #1: Yes
**********
5. Review Comments to the Author
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
Reviewer #1: This is a relatively straightforward study comparing two Abbott genotyping assays. The authors found that the new assay was able to correctly “genotyped” some of those that was either indeterminate or genotype 1 but no subtype using the new Plus assays, using sequencing as the gold standard.
1. There should be another control group, comparing the results between the Abbott Real Time HCV GT II with the Plus assays among those that were not indeterminate or no subtype. The study found that among those that were genotype (no subtype), significant numbers turned out to be genotype 6. Among those that were genotyped as 1a, 1b, 1c etc by the Abbott Real Time HCV GT II or Plus, what percentage turned out to be genotype 6? Does this a more common findings for those indeterminate sample only? This is an important question since the authors emphasized the importance of genotyping correctly.
2. For those no subtype or indeterminate, were they repeated again with GT II with same result or tested only once?
3. Among the G1 no subtype and in the indeterminate group, 8 samples in each group PCR failed. Was it due to the condition of the sample? This is one of the limitations of the study. This is particularly problematic for the indeterminate group, since this represented almost one quarter of the sample.
4. In the G1 no subtype group, 4 were “undetected” by the Plus assay. Were these undetected or indeterminate by the Plus assay?
5. The discussion should include existing literature on mistyping/problem with correctly identifying genotype 6. Currently, this was mentioned only briefly with only one reference (#35). This is an important point since genotype 6 is common in South Asia.
6. In the introduction section, the authors stated that “The precise diagnosis of genotyping is informative and critical for pretreatment assessment and subsequent therapeutic decision”. This sentence is actually incorrect. The significance of current study was markedly reduced with pangenotypic DAA regimen. EASL guidelines actually suggest genotyping is optimal in resources limited countries and should not be a barrier to DAA treatment, even though genotyping might be important. The MINMON studies reported an SVR rate of 95% with SOF/VEL in over 300 subjects without genotyping.
7. It would help the readers to understand better the significance of this study if the authors could also briefly describe the treatment landscape in Taiwan and insurance reimbursement scheme. Was the choice of DAA depend on the genotype instead of pangenotypic regimen as first line therapy? Was genotype required for reimbursement? Was there major cause differences between the pangenotypic DAA vs earlier DAA that were genotype specific?
**********
6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.
If you choose “no”, your identity will remain anonymous but your review may still be made public.
Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.
Reviewer #1: No
[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]
While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
PONE-D-20-35973
The performance of HCV GT Plus RUO reagent in determining hepatitis C virus genotypes in Taiwan
==============================
Review Comments to the Author
Reviewer #1: This is a relatively straightforward study comparing two Abbott genotyping assays. The authors found that the new assay was able to correctly “genotyped” some of those that was either indeterminate or genotype 1 but no subtype using the new Plus assays, using sequencing as the gold standard.
1. There should be another control group, comparing the results between the Abbott Real Time HCV GT II with the Plus assays among those that were not indeterminate or no subtype. The study found that among those that were genotype (no subtype), significant numbers turned out to be genotype 6. Among those that were genotyped as 1a, 1b, 1c etc by the Abbott Real Time HCV GT II or Plus, what percentage turned out to be genotype 6? Does this a more common findings for those indeterminate sample only? This is an important question since the authors emphasized the importance of genotyping correctly.
Reply: Thank you for the insightful comment. We fully agree with the reviewer that there should be another control group, comparing the results between the Abbott Real Time HCV GT II with the Plus assays among those that were not indeterminate or no subtype. We would like to add “We also recruited the HCV genotype 1 with subtype 1a or 1b and genotype 6 previously genotyped by Abbott RealTime HCV GT II as the positive control group.” in the Materials and Methods section and “For the positive control group, HCV GT Plus confirmed HCV GT II characterized results for 100% (3/3) of 1a, with 100% (2/2), 100% (3/3) for 1b and type 6, respectively, validated by 5' UTR sequencing as a reference standard” in the Results section.”
As subtype 1a and 1b previously genotyped by Abbott RealTime HCV GT II, would not be considered as genotype 6 by HCV GT Plus or direct sequencing. The misidentifying issue only occurred in genotype 1 without subtype 1a or 1b previously genotyped by Abbott RealTime HCV GT II. According to the data from our research , 54.1% (20/37) were tested as genotype 6 in indeterminate group, higher than 41.3% (26/63) misidentifying genotype 6 samples as genotype 1 without subtype 1a or 1b, genotyped by Abbott RealTime HCV GT Plus.
2. For those no subtype or indeterminate, were they repeated again with GT II with same result or tested only once?
Reply: Thank you for the comment. All samples were tested only once by GT II.
3. Among the G1 no subtype and in the indeterminate group, 8 samples in each group PCR failed. Was it due to the condition of the sample? This is one of the limitations of the study. This is particularly problematic for the indeterminate group, since this represented almost one quarter of the sample.
Reply: Thank you for the insightful comment. We fully agree with the reviewer that PCR failed will be the limitations of the study. All samples have been checked for quality before processing. The condition of all samples were normal without hemolysis, lipemia or jaundice in our study. The qualified samples were stored in -70 ° C for further HCV GT Plus testing according to the manufacturer’s manual.
4. In the G1 no subtype group, 4 were “undetected” by the Plus assay. Were these undetected or indeterminate by the Plus assay?
Reply: Thank you for the comment. These four samples were tested by the Plus assay, and the results showed not detected.
5. The discussion should include existing literature on mistyping/problem with correctly identifying genotype 6. Currently, this was mentioned only briefly with only one reference (#35). This is an important point since genotype 6 is common in South Asia.
Reply: Thank you for the insightful comment. We retrieve the existing literature on mistyping/problem with correctly identifying genotype 6 from PubMed, which is organized by National Center for Biotechnology Information (NCBI) of the United States of America. We would like to add the description “ The inability to distinguish HCV-6 subtypes might impact on predicted SVR to interferon (IFN)-based therapies in patients with apparent HCV-1 infection[1]. HCV G-6, highly prevalent in the Asia–Pacific region, can be incorrectly classified as HCV-1b because they share similar nucleotide homology in the 5′UTR [2]. Addition of Core motifs could improve the discrimination between HCV-1 and HCV-6 [3].” in Discussion section
6. In the introduction section, the authors stated that “The precise diagnosis of genotyping is informative and critical for pretreatment assessment and subsequent therapeutic decision”. This sentence is actually incorrect. The significance of current study was markedly reduced with pangenotypic DAA regimen. EASL guidelines actually suggest genotyping is optimal in resources limited countries and should not be a barrier to DAA treatment, even though genotyping might be important. The MINMON studies reported an SVR rate of 95% with SOF/VEL in over 300 subjects without genotyping.
Reply: Thank you for the insightful comment. We fully agree with the reviewer that HCV genotyping might not be warranted in the era with pangenotypic DAA regimens. We have omitted the description. We would like to add the description “ To scale up HCV care cascade and HCV elimination, HCV genotyping may not be warranted at the population level. At the individual level, HCV genotyping might help to facilitate HCV treatment plan in terms of difficult-to-cure population (ex. HCV genotype 3) or to distinguish potential virological failure from reinfection.”
7. It would help the readers to understand better the significance of this study if the authors could also briefly describe the treatment landscape in Taiwan and insurance reimbursement scheme. Was the choice of DAA depend on the genotype instead of pangenotypic regimen as first line therapy? Was genotype required for reimbursement? Was there major cause differences between the pangenotypic DAA vs earlier DAA that were genotype specific?
Reply: Thank you for the insightful comment. Taiwan government started to reimburse DAA with genotype specific regimens including daclatasvir /asunaprevir, paritaprevir/ritonavir/ombitasvir/dasabuvir, sofosbuvir/ledipasvir, sofosbuvir/ledipasvir and elbasvir/grazoprevir since 2017. For the pangenotypic DAAs, the National Health Insurance Administration of Taiwan start to reimburse glecaprevir/ pibrentasvir since Aug 2018 and sofosbuvir/velpatasvir since June 2019. Nowadays, available DAAs in Taiwan include elbasvir/grazoprevir, glecaprevir/ pibrentasvir and sofosbuvir/velpatasvir at the time of manuscript drafting. The choice of DAA regimens is at physicians’ discretion. Even though pangenotypic DAAs are available in Taiwan, it is mandatory to provide and upload HCV genotype data to the government while applying DAAs per request by the authority (https://www.nhi.gov.tw/Content_List.aspx?n=A4EFF6CD1C4891CA&topn=3FC7D09599D25979).
References
1. Dev AT, McCaw R, Sundararajan V, Bowden S, Sievert W. Southeast Asian patients with chronic hepatitis C: the impact of novel genotypes and race on treatment outcome. Hepatology (Baltimore, Md). 2002;36(5):1259-65.
2. McCaughan GW, Omata M, Amarapurkar D, Bowden S, Chow WC, Chutaputti A, et al. Asian Pacific Association for the Study of the Liver consensus statements on the diagnosis, management and treatment of hepatitis C virus infection. Journal of gastroenterology and hepatology. 2007;22(5):615-33.
3. Bouchardeau F, Cantaloube JF, Chevaliez S, Portal C, Razer A, Lefrère JJ, et al. Improvement of hepatitis C virus (HCV) genotype determination with the new version of the INNO-LiPA HCV assay. Journal of clinical microbiology. 2007;45(4):1140-5.
18 Jan 2021
The Performance of HCV GT Plus RUO Reagent in Determining Hepatitis C Virus Genotypes in Taiwan
PONE-D-20-35973R1
Dear Dr. Huang,
We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.
Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.
An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.
If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.
Kind regards,
Isabelle Chemin, PhD
Academic Editor
PLOS ONE
Additional Editor Comments (optional):
Reviewers' comments:
Reviewer's Responses to Questions
Comments to the Author
1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.
Reviewer #1: All comments have been addressed
**********
2. Is the manuscript technically sound, and do the data support the conclusions?
The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.
Reviewer #1: Yes
**********
3. Has the statistical analysis been performed appropriately and rigorously?
Reviewer #1: N/A
**********
4. Have the authors made all data underlying the findings in their manuscript fully available?
The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.
Reviewer #1: Yes
**********
5. Is the manuscript presented in an intelligible fashion and written in standard English?
PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.
Reviewer #1: Yes
**********
6. Review Comments to the Author
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
Reviewer #1: No new comments to the authors.
**********
7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.
If you choose “no”, your identity will remain anonymous but your review may still be made public.
Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.
Reviewer #1: No
21 Jan 2021
PONE-D-20-35973R1
The Performance of HCV GT Plus RUO Reagent in Determining Hepatitis C Virus Genotypes in Taiwan
Dear Dr. Huang:
I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.
If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.
If we can help with anything else, please email us at plosone@plos.org.
Thank you for submitting your work to PLOS ONE and supporting open access.
Kind regards,
PLOS ONE Editorial Office Staff
on behalf of
Mrs Isabelle Chemin
Academic Editor
PLOS ONE
Tweets
The performance of HCV GT plus RUO reagent in determining Hepatitis C virus genotypes in Taiwan
Twitter
Facebook
WhatsApp
LinkedIn
